Unlock instant, AI-driven research and patent intelligence for your innovation.

Corn pollen specific promoter and application thereof

A corn pollen and promoter technology, applied in the biological field, can solve the problems of large manpower, material resources, increase the cost of corn hybrid seed production, etc., and achieve the effect of broad application prospects.

Active Publication Date: 2020-08-25
SHENYANG AGRI UNIV
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The process of artificial detasseling and pollination requires a lot of manpower and material resources, which greatly increases the cost of hybrid corn seed production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Corn pollen specific promoter and application thereof
  • Corn pollen specific promoter and application thereof
  • Corn pollen specific promoter and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1. Cloning of maize pollen-specific promoter sequence pPSP1

[0049] After sterilizing the surface of the seeds of the corn cultivar McC, place them in a petri dish covered with wet filter paper, and cultivate them at 24-28°C for 3-5 days to make them grow young leaves, collect 2g of fresh and tender seedlings, and extract the total DNA, take 2-3μL DNA sample, and use agarose gel electrophoresis to detect the purity and concentration.

[0050] Design cloning primers, F: AGTAGGCCAAAATTTCCAAACA; R: CAGCTCCTGCTCCAAGATTGACG, use the above primers for PCR reaction, the reaction components are as follows: LA taq polymerase 0.2μL, GC buffer 5μL, dNTP 1.5μL, F primer 0.2μL, R primer 0.2μL, Template DNA 2μL , ddH 2 O 1.9 μL.

[0051] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 2 min, 35 cycles of amplification, extension at 72°C for 5 min, and storage at ...

Embodiment 2

[0052] Example 2. Construction of plant expression vector pCambia1301-pPSP1-GUS

[0053] Build process such as figure 2 As shown, the pMD19T-pPSP1-HN plasmid (constructed in Example 1) was extracted by alkali cleavage method, and after HindIII and NcoI double digestion, the pPSP1 promoter fragment with HindIII and NcoI restriction sites was obtained, which was similarly digested with The large fragment of the plant expression vector pCambia1301 was ligated, and then the ligated product was transformed into 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( The LB liquid medium with a final concentration of 100 μg / ml) was cultured overnight, and the bacterial cells were collected by centrifugation to extract the plasmid by alkaline lysis, which was identified by restriction endonuclease HindIII and NcoI...

Embodiment 3

[0054] Example 3. pCambia1301-pPSP-GUS expression vector transformation of maize germinated embryos

[0055] The recombinant plant expression vector pCambia1301-pPSP1-GUS constructed in Example 2 was transformed into Agrobacterium tumefaciens EHA105 by freezing and thawing, and the transformation method was referred to [Hofen R, Willmitzer L, (1988) Storage ofcompetent cells for Agrobacterium transformation. Acids Research, 16, 9877].

[0056] Utilize the method for exogenous gene transformation of maize germination embryo, operate according to the test procedure of people such as Wang (2007), as follows:

[0057](1) Agrobacterium liquid preparation: pick and identify positive Agrobacterium colonies (pCambia1301-pPSP1-GUS), inoculate them into 50mL YEB liquid medium containing Kanamycin and Rifampicin antibiotics, keep the temperature at 28°C, shake at 200rpm for 8-12hr , measure OD 600 A value of 0.8 is used directly for infection;

[0058] (2) Preparation of corn receptor...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a corn pollen specific promoter and application thereof. The corn pollen specific promoter has a sequence shown as SEQ ID NO. 1 or a DNA sequence which can be hybridized with the sequence shown as SEQ ID NO. 1 under a strict condition and has promoter activity. The corn pollen specific high-efficiency expression promoter provided by the invention has important application value when a pollen abortion material is created by a genetic engineering means, for example, the promoter sequence is connected with an antisense gene of a gene necessary for pollen development or isconstructed into an RNA interference vector, and the gene necessary for pollen development can be silently expressed in pollen by transforming the RNA interference vector into a plant to generate a pollen abortion plant, so that adverse effects caused by continuous expression of a target gene at other parts are avoided. The invention provides a novel method for driving the target gene to be efficiently and specifically expressed in the pollen by using the promoter, and the method has wide application prospect in the aspects of genetic improvement of plants and research of plant bioreactors.

Description

technical field [0001] The invention relates to a promoter and its application, in particular to a corn pollen-specific promoter and its application. The invention belongs to the field of biotechnology. Background technique [0002] Promoter is a DNA sequence that RNA polymerase recognizes, binds and initiates transcription. It contains the conserved sequence required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription initiation point of structural genes. The promoter itself is not Transcription, a DNA sequence necessary for the expression of eukaryotic genes. In the process of research and application of transgenic plants, it was found that the low expression level of exogenous genes is an important factor causing the unsatisfactory target traits of transgenic plants and the insignificant phenotype when studying the mechanism of gene action. Since the expression level of the target gene depends critical...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8231C12N15/8289
Inventor 刘琛林凤张春宇范眀霞孙权李楠
Owner SHENYANG AGRI UNIV