Corn pollen specific promoter and application thereof
A corn pollen and promoter technology, applied in the biological field, can solve the problems of large manpower, material resources, increase the cost of corn hybrid seed production, etc., and achieve the effect of broad application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1. Cloning of maize pollen-specific promoter sequence pPSP1
[0049] After sterilizing the surface of the seeds of the corn cultivar McC, place them in a petri dish covered with wet filter paper, and cultivate them at 24-28°C for 3-5 days to make them grow young leaves, collect 2g of fresh and tender seedlings, and extract the total DNA, take 2-3μL DNA sample, and use agarose gel electrophoresis to detect the purity and concentration.
[0050] Design cloning primers, F: AGTAGGCCAAAATTTCCAAACA; R: CAGCTCCTGCTCCAAGATTGACG, use the above primers for PCR reaction, the reaction components are as follows: LA taq polymerase 0.2μL, GC buffer 5μL, dNTP 1.5μL, F primer 0.2μL, R primer 0.2μL, Template DNA 2μL , ddH 2 O 1.9 μL.
[0051] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, denaturation at 94°C for 1 min, annealing at 56°C for 1 min, extension at 72°C for 2 min, 35 cycles of amplification, extension at 72°C for 5 min, and storage at ...
Embodiment 2
[0052] Example 2. Construction of plant expression vector pCambia1301-pPSP1-GUS
[0053] Build process such as figure 2 As shown, the pMD19T-pPSP1-HN plasmid (constructed in Example 1) was extracted by alkali cleavage method, and after HindIII and NcoI double digestion, the pPSP1 promoter fragment with HindIII and NcoI restriction sites was obtained, which was similarly digested with The large fragment of the plant expression vector pCambia1301 was ligated, and then the ligated product was transformed into 2 In E. coli DH5α competent cells treated by the method, cultivate overnight on LB solid medium containing kanamycin (final concentration 100 μg / ml); pick the white colony grown on the plate, insert into containing kanamycin ( The LB liquid medium with a final concentration of 100 μg / ml) was cultured overnight, and the bacterial cells were collected by centrifugation to extract the plasmid by alkaline lysis, which was identified by restriction endonuclease HindIII and NcoI...
Embodiment 3
[0054] Example 3. pCambia1301-pPSP-GUS expression vector transformation of maize germinated embryos
[0055] The recombinant plant expression vector pCambia1301-pPSP1-GUS constructed in Example 2 was transformed into Agrobacterium tumefaciens EHA105 by freezing and thawing, and the transformation method was referred to [Hofen R, Willmitzer L, (1988) Storage ofcompetent cells for Agrobacterium transformation. Acids Research, 16, 9877].
[0056] Utilize the method for exogenous gene transformation of maize germination embryo, operate according to the test procedure of people such as Wang (2007), as follows:
[0057](1) Agrobacterium liquid preparation: pick and identify positive Agrobacterium colonies (pCambia1301-pPSP1-GUS), inoculate them into 50mL YEB liquid medium containing Kanamycin and Rifampicin antibiotics, keep the temperature at 28°C, shake at 200rpm for 8-12hr , measure OD 600 A value of 0.8 is used directly for infection;
[0058] (2) Preparation of corn receptor...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


