Polyclonal antibody of rice stripe virus nucleocapsid protein as well as preparation method and application thereof

A technology of rice stripe virus and nucleocapsid protein, applied in antiviral immunoglobulin, virus/bacteriophage, botanical equipment and methods, etc., can solve the problem of unsuitable batch operation, high cost and instrument requirements, and monoclonal antibody performance Instability and other problems, to achieve the effect of disease monitoring

Active Publication Date: 2020-09-01
YANGZHOU UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the commonly used detection methods for rice stripe leaf blight virus in SBPH at home and abroad include RT-PCR, Northern, DIBA and ELISA, etc. RT-PCR and Northern have high cost and equipment requirements, and are not suitable for batch operation
The virus monoclonal antibody developed by Zhou Yijun's team can be used for DIBA and ELISA detection. Its simplicity and speed are suitable for grassroots agricultural technicians. However, the monoclonal antibody is unstable in WB, IF and IM detection, and cannot meet the expectations of scientific researchers Experimental requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polyclonal antibody of rice stripe virus nucleocapsid protein as well as preparation method and application thereof
  • Polyclonal antibody of rice stripe virus nucleocapsid protein as well as preparation method and application thereof
  • Polyclonal antibody of rice stripe virus nucleocapsid protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0028] In the present invention, the preparation method of the recombinant vector preferably includes the following steps: 1) extracting the total RNA of SBPH with rice stripe virus, and obtaining cDNA by reverse transcription; 2) performing PCR amplification using the cDNA as a template 3) transform Escherichia coli to obtain CP / pMD-19T plasmid after connecting said gene fragment with pMD-19T carrier; 4) After double enzyme digestion of said CP / pMD-19T plasmid, reclaim The gene fragment encoding CP is connected with the pET-28a vector to obtain the recombinant vector.

[0029] In the present invention, the total RNA of SBPH carrying rice stripe virus is extracted, and cDNA is obtained by reverse transcription. In the present invention, the extraction of the total RNA preferably adopts the TRIzol method, and in the specific implementation process of the present invention, it is preferably carried out using a kit, and the kit is preferably TRIzol TM LS Reagent, 10296010, Ther...

Embodiment 1

[0046] Construction of CP / pET-28a prokaryotic expression vector:

[0047] Sequence amplification of rice stripe virus CP: TRIzol method (TRIzol TM LS Reagent, 10296010, ThermoFisher, USA) was used to extract the total RNA of the poisonous SBPH; the extracted total RNA was used as a template for reverse transcription to obtain cDNA; the reverse transcription was carried out using the TAKARA Reverse Transcription Kit, see the kit instructions for operation .

[0048] The CP gene was obtained by PCR amplification using cDNA as template.

[0049] Specific primers for PCR amplification:

[0050] CP-BamHI-R: TAGGATCCCTAGTCATCTGC (SEQ ID No. 3);

[0051] CP-NocI-F: TACCATGGatGTGGGACTATGT (SEQ ID No. 4).

[0052] The PCR amplification system is shown in Table 1.

[0053] Table 1 PCR amplification system

[0054]

[0055] PCR amplification program:

[0056] (1) Pre-denaturation at 94°C for 3 minutes;

[0057] (2) Denaturation at 94°C for 30s, annealing at 56°C for 30s, exte...

Embodiment 2

[0064] CP / pET-28a recombinant plasmid construction: The CP fragment recovered in Example 1 was ligated with the pMD-19T vector at a molar ratio of 3:1 with Solution I ligase at 16°C for 30 min. The ligation product was transformed into Escherichia coli by heat shock method, and positive colonies were screened by resistance and blue-white screening. After sequencing and identification, store the CP / pMD-19T plasmid at -20°C.

[0065] Add 1 μl of BamHI (15U / μl) and NcoI (15U / μl) enzymes to the 50 μl system to digest CP / pMD-19T, and the target fragment and pET-28a vector after gel cutting and recovery according to 3: 1. Connect at 16°C for 30 minutes. Transform Escherichia coli to screen positive clones, identify them by sequencing, and obtain CP / pET-28a prokaryotic expression vector.

[0066] Prokaryotic expression of CP fusion protein:

[0067] (1) Cultivation of CP / pET-28a transformed Escherichia coli: the recombinant plasmid CP / pET-28a was transformed into Escherichia coli ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a preparation method and application of a polyclonal antibody of a rice stripe virus nucleocapsid protein, and belongs to the technical field of rice stripe virus detection. Thepolyclonal antibody of the rice stripe virus nucleocapsid protein CP is obtained by immunizing animals with the rice stripe virus nucleocapsid protein CP as immunogen; and the amino acid sequence ofthe rice stripe virus nucleocapsid protein CP is as shown in SEQ ID No. 1. The polyclonal antibody of the rice stripe virus nucleocapsid protein has the characteristics of low cost, wide application range, multiple audiences, high sensitivity, and the like, and can be used for multiple biological detection experiments such as an immune spot determination method, an enzyme-linked immunosorbent assay method, a protein immunoblotting method, an immuno-fluorescence method, an immuno-electron microscopy method, and the like. By utilizing the disclosed polyclonal antibody, disease early warning is carried out through small brown rice plant hoppers at the beginning of outbreak of rice stripe disease, and multi-means disease monitoring is facilitated.

Description

technical field [0001] The invention belongs to the technical field of detection of rice stripe virus, and in particular relates to a polyclonal antibody of rice stripe virus nucleocapsid protein and a preparation method and application thereof. Background technique [0002] Rice stripe virus (RSV) belongs to the genus Parvovirus. Rice stripe leaf blight caused by rice stripe virus is a serious disease in temperate and subtropical rice in East Asia. The disease was first discovered in Japan's Tochigi and Gunma prefectures in 1987, and later spread to North Korea, Russia, Ukraine and China. Since my country started in Jiangsu and Zhejiang in 1963, it has spread to 16 provinces, municipalities and autonomous regions including Shanghai, Fujian, Shandong, Jiangxi, Anhui, Hubei, Guangxi, Guangdong, Hebei, Henan, Liaoning, Yunnan and Taiwan. Since 2000, it has been common in northern Jiangsu, northern Zhejiang, Chuxiong, Baoshan, Yunnan, Shuangqiao, Beijing, Yuanyang, Henan, and...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/08C07K16/10C07K16/06C12N15/40C12N15/70C12N1/21G01N33/569C12R1/19
CPCC07K14/005C07K16/065C07K16/10C07K2317/20C12N15/70C12N2760/00022G01N33/56983G01N2469/10
Inventor李尧陈丹玉刘芳
OwnerYANGZHOU UNIV