Method for regulating proportion of S/G type lignin and improving degradation and conversion efficiency of cell walls by using laccase PtoLAC14

A lignin and gene technology, applied in the field of genetic engineering, can solve the problems of improving lignin, and achieve the effect of reducing the content of G-type lignin, improving the degradability and reducing the total content

Active Publication Date: 2020-09-29
SOUTHWEST UNIVERSITY
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there is no report on modifying lignin and improving the efficiency of cell wall degradation by editing the laccase gene with CRISPR / Cas9 technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for regulating proportion of S/G type lignin and improving degradation and conversion efficiency of cell walls by using laccase PtoLAC14
  • Method for regulating proportion of S/G type lignin and improving degradation and conversion efficiency of cell walls by using laccase PtoLAC14
  • Method for regulating proportion of S/G type lignin and improving degradation and conversion efficiency of cell walls by using laccase PtoLAC14

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0021] 1. Example 1: PtoLAC14 gene cloning

[0022] Design specific primers, use Populus tomentosa cDNA as a template, perform PCR amplification, recover the product, and sequence to obtain the CDS sequence of PtoLAC14 with a length of 1677bp. The CDS sequence of PtoLAC14 is shown in SEQ ID No.1. The primers are as follows,

[0023] Forward primer: ATGGAGTACGCTTGCTGGCTCC (SEQ ID No. 2); reverse primer: TCAACATTTTGGAAGGTCGCTT (SEQ ID No. 3).

Embodiment 2

[0024] 2. Example 2: PtoLAC14 protein induction purification and enzyme activity assay

[0025] 1. Construct the prokaryotic expression vector of PtoLAC14 protein. The prokaryotic expression vector used in the present invention is pET32a + , the Escherichia coli strain for prokaryotic induced expression is BL21.

[0026] 2. Determination of laccase activity of PtoLAC14 fusion protein. The invention uses ABTS as a substrate to measure the laccase activity of PtoLAC14 fusion protein.

[0027] ABTS (2,2'-azino-bis-(3-ethylbenzodihydrothiazoline-6-sulfonic acid) diammonium salt) is a synthetic compound specially used for the determination of laccase activity. Enzymatic oxidation produces dark green cationic free radical ABTS + , ABTS at 420nm + The absorption coefficient of free radicals is much larger than that of the substrate ABTS. With ABTS + As the concentration of free radicals increases, the absorbance value becomes larger. The time elapsed when the absorbance value...

Embodiment 3

[0066] Three. Example 3: Construction of CRISPR / Cas9 editing vector

[0067] According to the CDS sequence of PtoLAC14, design the target sites at the 1st and 3rd exons respectively, connect to the U3b and U3d promoters, and connect to the pYLCRISPR / Cas9-DH / B vector backbone in sequence. The primers are as follows, Vector construction as attached figure 2 shown.

[0068] Target 1, forward primer: GTCACCCTGCTTTGGTCCAGTGCA (SEQ ID No.4), reverse primer: AAACTGCACTGGACCAAAGCAGGG (SEQ ID No.5);

[0069] Target 2, forward primer: GTCAGCGTTTAGGCAAGACAACCA (SEQ ID No.6), reverse primer: AAACTGGTTGTCTTGCCTAAACGC (SEQ ID No.7);

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for regulating the proportion of S / G type lignin and improving the degradation and conversion efficiency of cell walls by using laccase PtoLAC14, and belongs to the technical field of plant genetic engineering. The CDS sequence of the PtoLAC14 is shown as SEQ ID No. 1. It is discovered for the first time that the populus tomentosa PtoLAC14 can specifically regulateand control polymerization of G-type lignin monomers, and the PtoLAC14 is edited by using a CRISPR / Cas9 technology, so that transgenic plants with reduced total lignin content, reduced G-type lignincontent and increased lignin S / G ratio are obtained; the cell wall degradability of the transgenic plants is obviously improved, so that the removal cost of lignin during biological energy source production and papermaking is reduced. The invention lays a foundation for lignin genetic improvement and directed molecular breeding of plants, provides a new gene resource for plant genetic engineering,and has a wide application prospect.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a gene and a regulation method for regulating the ratio of S / G type lignin in poplar trees. Background technique [0002] Poplar (Populus spp.) is the most widely planted fast-growing tree species in the world. It is an important raw material for papermaking and construction, and it is also the main raw material for the bioenergy industry (Wang et al., 2012). However, in the development and utilization of poplar, the existence of lignin (Lignin) directly affects its production cost (Baucher et al., 2003). For example, in the process of biomass energy production, pretreatment is required to remove lignin, and the lignin component must also be removed in papermaking. Therefore, it is of great scientific significance and industrial significance to study the regulation mechanism of plant lignin biosynthesis, reduce the content of lignin in wood or change its components...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/53C12N15/11C12N15/82A01H5/00A01H6/00
CPCC12N9/0061C12N15/8218C12N15/8255C12Y110/03002
Inventor范春芬罗克明秦士飞
OwnerSOUTHWEST UNIVERSITY