10 results about "Lignin biosynthesis" patented technology

The invention discloses a pear PbrRGL3 gene and application of the pear PbrRGL3 gene. The PbrRGL3 gene which is separated from Dangshan pears and has the effect of inhibiting the formation of pear cell lignin has a nucleotide sequence as shown in SEQ ID No. 1, and an amino acid sequence coded by the PbrRGL3 gene is as shown in SEQ ID No. 2 in a sequence table. The PbrRGL3 gene is subjected to transient overexpression in pear fruits by adopting an agrobacterium transient transformation method, the lignin content of pulp is remarkably reduced, and the expression of a lignin biosynthetic gene is reduced; the effect of silencing the PbrRGL3 gene is opposite to that of silencing the PbrRGL3 gene; an overexpression vector constructed by the gene is introduced into arabidopsis thaliana, the lignin content of inflorescence stems of the obtained PbrRGL3 transgenic arabidopsis thaliana is remarkably reduced, and the lignification degree of conduit cells and vascular intervascular fibrocytes is weakened. Therefore, the PbrRGL3 participates in regulating and controlling the formation of the lignin in the pear fruit stone cells.

The invention belongs to the technical field of agricultural biological genetic engineering, and particularly discloses application of a PbbHLH96 gene in regulation and control of pear fruit lignin synthesis and / or stone cell formation. According to the application of the PbHLH96 gene in regulation and control of lignin synthesis and / or stone cell formation of pear fruits, the nucleotide sequence of the PbHLH96 gene is as shown in SEQ ID NO. 1. The PbHLH96 gene is directly combined with a PbCAD6 promoter region to inhibit transcription of the PbHLH96 gene, so that biological synthesis of lignin of pear fruits is negatively regulated, and the PbHLH96 gene has a great application value for improving the quality of the pear fruits.

The invention discloses a pear PbrGA2ox1-1 gene and an application of the pear PbrGA2ox1-1 gene. The invention relates to a PbrGA2ox1-1 gene which is separated from Dangshan pear and is capable of regulating formation of lignin in stone cells of pear fruits. The nucleotide sequence of the PbrGA2ox1-1 gene is shown as SEQ ID No.1. According to the present invention, the PbrGA2ox1-1 gene is subjected to instantaneous overexpression in the pear fruit by using the agrobacterium instantaneous transformation method, the lignin content in the pulp is significantly reduced, and compared with the wild type pear pulp callus, the lignin content in the transgenic pear callus subjected to the overexpression of PbrGA2ox1-1 is significantly reduced, and the expression of a series of key genes in a lignin biosynthesis pathway is obviously inhibited. Therefore, the PbrGA2ox1-1 participates in regulating and controlling the formation of the lignin in the stone cells of the pear fruits. The discovery of the gene provides a new gene resource for fruit quality breeding, and the gene is an important candidate gene for improving fruit quality breeding in future genetic engineering.

The invention discloses a soybean GmUBC13 gene, an encoding protein thereof and application of the soybean GmUBC13 gene in negative regulation and control of lignin synthesis and phytophthora root rot resistance, and belongs to the technical field of biology, and the nucleotide sequence of the soybean GmUBC13 gene is shown as SEQ ID NO: 1. The amino acid sequence of the protein coded by the gene is as shown in SEQ ID NO: 2. According to the invention, it is found for the first time that the soybean GmUBC13 gene can negatively regulate lignin biosynthesis and the resistance of soybean to phytophthora root rot, that is, the GmUBC13 gene and the encoded protein thereof are successfully cloned from soybean, and it is confirmed for the first time by systematic functional experiments that the gene encodes an active E2 ubiquitin coupling enzyme. The overexpression of the gene can significantly inhibit the biosynthesis of soybean lignin, and the interference of the expression of the gene can promote the accumulation of lignin, so that the blank about a key negative regulation element in a lignin synthesis regulation network is filled.

The invention discloses an application of an AcLAC1 gene in genetic transformation and disease resistance of nicotiana benthamiana. The AcLAC1 gene is characterized in that a coding sequence of the AcLAC1 gene is obtained by amplifying a primer pair BG-AcLAC1: F: aGAATTCGAGCTCGGTACCCATGGATGCCTCAACAG and a primer pair BG-AcLAC1: R: GTCGACTCTAGGATCCCACATAGGGGGCAGATCTGA; when the overexpression vector is constructed, a BG-plant-express vector is adopted, the BG-plant-express vector is subjected to enzyme digestion for 30 min at 37 DEG C through restriction endonuclease Sma I for linearization, and then the BG-plant-express vector is recombined with a recovered AcLAC1 gene segment; the recombinant vector is mediated by agrobacterium tumefaciens to instantaneously transform Bensi tobacco leaves. According to the invention, nicotiana benthamiana is taken as an object, an AcLAC1 overexpression strain is constructed through an agrobacterium tumefaciens-mediated stable genetic transformation technology, and subcellular localization of AcLAC1, a regulation mechanism of lignin biosynthesis and a function of the AcLAC1 in disease resistance of nicotiana benthamiana are clarified; a theoretical basis is provided for understanding the biological function of the laccase gene, and candidate gene resources and technical support are provided for breeding of disease-resistant molecules.

The invention belongs to the technical field of plant genetic engineering, and particularly relates to application of a PbMYB78 gene in regulation and control of accumulation of anthocyanin and lignin in pear peel. The key gene PbMYB78 capable of simultaneously regulating and controlling biosynthesis of the anthocyanin and the lignin in the pear peel is found for the first time, and accumulation of the anthocyanin and the lignin in the pear peel can be promoted by the key gene PbMYB78. The invention provides a new gene target for pear quality improvement and variety improvement, and has good practical application value.

The invention provides application of a CsWRKY41 gene in regulation and control of plant lignin synthesis, and belongs to the technical field of plant genetic engineering. A plant overexpression vector and a gene silencing vector of the CsWRKY41 gene are constructed and are respectively subjected to genetic transformation in arabidopsis thaliana and a tea tree, and the result proves that the lignin content of a transgenic plant can be obviously improved by overexpressing the CsWRKY41 gene; on the contrary, silencing of the gene leads to reduction of lignin content. The invention discloses a molecular mechanism of the tea tree CsWRKY41 gene for enhancing plant drought resistance by positively regulating lignin biosynthesis for the first time. The gene and the related expression vector can be used for cultivating tea trees with high lignin content and strong drought resistance and even other new forest or crop varieties, and have wide application prospects in agricultural water conservation and stress resistance breeding.

The application discloses application of a GbTCP20 gene in improving cotton Verticillium wilt resistance and belongs to the technical field of biotechnology.The GbTCP20 gene disclosed by the application encodes a TCP transcription factor.The application provides a full-length ORF nucleotide sequence and an amino acid sequence of the GbTCP20 in a Gossypium hirsutum var. hirsutum L. variety Hai7124.The expression of the gene is significantly up-regulated by a Verticillium albo-atrum Eulge et Hunter induction.Silencing of the GbTCP20 expression in cotton weakens the Verticillium wilt resistance.Overexpression of the cotton GbTCP20 in Arabidopsis thaliana enhances the Verticillium wilt resistance.The cotton GbTCP20 positively regulates lignin biosynthesis, and the combination of molecular biology technology and plant physiology experiments reveals that the GbTCP20 positively regulates lignin biosynthesis to endow the cotton with Verticillium wilt resistance.

The invention relates to the technical field of tissue culture, in particular to a method for producing S-type lignin in coniferous trees through efficient genetic transformation. The efficient genetic transformation system research of the species is developed by taking mature zygotic embryos of larix olgensis as initial explants, a brand-new genetic transformation system of larix olgensis is established, and a foundation is laid for research and application of genetic engineering breeding, gene editing, high-quality seedling breeding and the like of the species; meanwhile, the enzyme gene CALd5H for specifically synthesizing the S-type lignin is inserted into a larch genome by utilizing an efficient genetic transformation means, so that the larch genome has an S-type lignin biosynthesis pathway, and an effective strategy is created for increasing the pulping and papermaking utilization rate of the larch.

The application belongs to the field of plant biotechnology, and specifically discloses a Punica granatum ABCG9 gene and application thereof. The PgABCG9 gene of the Punica granatum is cloned for the first time, and the nucleic acid sequence is shown as SEQ ID No. 1. The PgABCG9 is only expressed in the inner seed coat of the Punica granatum, and the transcription level is negatively correlated with the hardness of the Punica granatum seeds. Under the same growth conditions, the PgABCG9 transgenic Arabidopsis plants show slow growth, reduced lignin deposition, reduced expression level of lignin biosynthesis genes, and reduced content of metabolic products in the lignin biosynthesis pathway. Subcellular localization analysis shows that the PgABCG9 is located in the Golgi apparatus. The PgABCG9 plays a negative regulation role in the lignin biosynthesis, and can regulate the lignin synthesis of the inner seed coat of the Punica granatum, and adjust the kernel hardness, thereby laying a foundation for improving the fruit quality of the Punica granatum and other drupes from the direction of lignin in the future.