Check patentability & draft patents in minutes with Patsnap Eureka AI!

Rice selenium-rich gene OsHSE2-1 and application thereof

A technology of transgenic plants and amino acids, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problem of few genes related to selenium accumulation in rice, achieve the effect of enhancing selenium accumulation ability, increasing selenium content, and increasing rice selenium content

Active Publication Date: 2020-11-10
INST OF AGRI PROD QUALITY SAFETY & STANDARD JIANGXI ACAD OF AGRI SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are still few genes related to selenium accumulation in rice that have been identified in the industry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Rice selenium-rich gene OsHSE2-1 and application thereof
  • Rice selenium-rich gene OsHSE2-1 and application thereof
  • Rice selenium-rich gene OsHSE2-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] The gene and cDNA clone of embodiment 1 rice OsHSE2-1

[0054] The rice variety Wuyanjing was provided by the National Crop Germplasm Bank, and the materials were planted in greenhouses and managed in the field. Using bioinformatics methods to analyze, design primers, and clone the rice gene OsHSE2-1, the specific methods are as follows:

[0055] Two-week-old young leaves of rice variety Wuyanjing were taken and ground in liquid nitrogen. RNA extraction was carried out according to TIANGEN total RNA extraction kit RNA Plant Extraction kit DP417. The first strand of cDNA was synthesized according to the cDNA first strand synthesis kit TaKaRa PrimeScriptTM 1st strand cDNA Synthesis KitD6110A provided by TaKaRa Reagent Company. For details, please refer to the operating instructions. Using the obtained cDNA fragment as a template, a PCR amplification reaction was performed using the primer pair ATGCAAGCTAAAGAATCCAA (SEQ ID NO: 3) and TCATTCATCACCCCTTGTG (SEQ ID NO: 4). 2...

Embodiment 2

[0057] Example 2 Obtaining of OsHSE2-1 transgenic rice

[0058] 1. Acquisition of pCAMBIA1301-OsHSE2-1 expression vector

[0059] The DNA molecule shown in SEQ ID NO.5 is inserted between BamHI and EcoRI in the pCAMBIA1301 vector, and the pCAMBIA1301-OsHSE2-1 vector (not limited to pCAMBIA1301, as long as it can express the protein whose amino acid sequence is shown in SEQ ID NO: 7), transform Escherichia coli TOP10, and the transformation solution is spread on LB solid medium containing 50 mg / L kanamycin to screen positive clones. After being verified by sequencing, the plasmid was extracted to obtain the plant overexpression vector pCAMBIA1301-OsHSE2-1.

[0060] 2. Obtaining of OsHSE2-1 transgenic rice

[0061] pCAMBIA1301-OsHSE2-1 was transformed into Agrobacterium tumefaciens strain EHA105 by freeze-thaw method. The wild-type rice Zhonghua 11 was respectively transformed by Agrobacterium EHA105. The genomic DNA of transgenic rice was extracted as a template, the wild-t...

Embodiment 3

[0063] Example 3 Functional verification of OsHSE2-1 protein

[0064] Disinfect 5 copies of the T1 generation positive transgenic Zhonghua 11 rice seeds obtained in Example 2 and sow them in tissue culture bottles at a culture temperature of 28°C and a day and night time of 12 / 12 hours; after the rice grows for 3 weeks, transplant it into a potted plant. In the selenium soil, the soil selenium content is 1.0mg / kg, and 4 plants are planted in each pot, and each material (ie OsHSE2-1-1, OsHSE2-1-2, OsHSE2-1-3, OsHSE2-1-4 or OsHSE2- 1-5) Plant 3 pots. The preparation method of the selenium-enriched soil is: each plastic bucket contains 10kg of crushed and sieved air-dried soil (collected at the Nanchang Liantang Experimental Base of Jiangxi Academy of Agricultural Sciences), and 10mg of selenium is added 90 days before transplanting (in the form of 20mg / L sub Sodium selenate (in the form of an aqueous solution of sodium selenate) is mixed evenly, so that the selenium content add...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an application of protein in regulating and controlling the selenium content of plant tissues and / or organs. The protein is any one of the following proteins: a) protein with anamino acid sequence as shown in SEQ ID No.7; b) fusion protein obtained by connecting a label to an N terminal or / and C terminal of the protein as shown in SEQ ID No.7; and c) protein related to selenium metabolism and obtained by substituting and / or deleting and / or adding one or more amino acid residues to the amino acid sequence as shown in SEQ ID No.7. The selenium content of the plant tissuesand / or organs is regulated and controlled to increase the selenium content of the plant tissues and / or organs. The selenium content in the plant tissues and / or organs is regulated and controlled to increase the selenium content in the plant tissues and / or organs. The organs are seeds; and plants are spermatophytes.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rice gene OsHSE2-1 and its application. Background technique [0002] Selenium is an essential trace element for humans and animals, and an important component to maintain enzyme activity, and participates in important physiological processes of immunity and anti-cancer. Studies have found that a variety of diseases in the human body are related to selenium deficiency, such as anemia, cancer, hepatitis, etc. Therefore, it is very necessary to take an appropriate amount of selenium to maintain human health. From a global perspective, soil selenium deficiency is very common. About 72% of cities and counties in China are in a state of severe selenium deficiency or low selenium. People in selenium-deficient areas eat selenium-rich agricultural products is the most economical, effective, safe and convenient way to supplement selenium. [0003] Rice is the main food crop in my country. ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82A01H5/00A01H6/46C12Q1/6895C12N15/11
CPCC07K14/415C12N15/8243C12Q1/6895C12Q2600/13C12Q2600/158
Inventor 张标金严松昌晓宇孙建邹国兴张祥喜史华新陈武龙万建林雷应国邹晓阳周瑶敏陈庆隆
Owner INST OF AGRI PROD QUALITY SAFETY & STANDARD JIANGXI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More