Unlock instant, AI-driven research and patent intelligence for your innovation.

Panax ginseng pgbhlh149 transcription factor and its application

A technology of pgbhlh149 and transcription factors, applied in application, genetic engineering, plant genetic improvement, etc., can solve problems such as economic losses, restrict the health and sustainable development of the ginseng industry, affect the economic benefits of ginseng planting, and achieve the effect of improving resistance

Active Publication Date: 2021-11-23
INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In Fusong and other areas of Jilin Province, the incidence rate of some plots is sometimes as high as 80%, which has caused huge economic losses to ginseng farmers, seriously affected the economic benefits of ginseng planting, and restricted the healthy and sustainable development of my country's ginseng industry.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Panax ginseng pgbhlh149 transcription factor and its application
  • Panax ginseng pgbhlh149 transcription factor and its application
  • Panax ginseng pgbhlh149 transcription factor and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0051] Example 1 Screening of ginseng iron toxicity-related transcription factor gene PgbHLH149

[0052] The ginseng seedlings were treated with 0.05mM Fe (normal iron concentration), 0.4mM Fe (iron toxicity stress), 0.4mM Fe+Si (0.5mM, 1.5mM, 2.0mM) respectively, and the effective screening for relieving the iron toxicity stress of ginseng was screened. Exogenous substances and their appropriate concentrations, it was found that adding an appropriate amount of silicon (0.5mM) under iron toxicity stress can effectively alleviate the symptoms of iron toxicity in ginseng (see figure 1 with figure 2 ).

[0053] Tissues such as ginseng roots, stems and leaves under different iron treatment conditions were taken, and part of the experimental samples were quick-frozen in liquid nitrogen and stored at -80°C for RNA extraction. Another part of the samples were dried in an oven at 105°C for 30 minutes, and dried at 80°C to constant weight for elemental composition analysis.

[0054...

Embodiment 2

[0063] Example 2 Cloning and sequencing of ginseng iron toxicity-related transcription factor gene—PgbHLH149 gene

[0064] Since the PgbHLH149 gene sequence information provided by the transcriptome analysis results may not be 100% accurate, the inventors of the present application re-amplified and sequenced the PgbHLH149 gene: using ginseng cDNA as a template, the PgbHLH149 gene sequence was divided into multiple small fragments for amplification. In addition, the sequences of multiple small fragments are designed to overlap and overlap at the beginning and end, and the multiple small fragments are sequenced separately. After the sequencing results are spliced, the complete sequence of the PgbHLH149 gene is obtained.

[0065] The extracted ginseng total RNA was synthesized into cDNA using M-MuLV First Strand cDNA Synthesis Kit M-MuLV First Strand cDNA Synthesis Kit, and used as a template for PCR amplification. Design multiple pairs of primers for amplifying the full-length c...

Embodiment 3

[0085] Example 3 PgbHLH149 gene transfer into Arabidopsis test

[0086] Vector construction experiment:

[0087] 1. Primer design:

[0088] bHLH149-F:AGAACACGGGGGACGAGCTCATGGTATCATTATTTATCTCGAATCCCGA

[0089] bHLH149-R:CCATGGTGTCGACTCTAGAGGATCCTAAAGTCGATGATTGGGATAAATTTGAGC

[0090] 2. Target gene amplification PCR reaction system:

[0091] reaction system Usage amount 2×fast pfu master mix 10.0μl Primer bHLH149-F 1μl Primer bHLH149-R 1μl cDNA 1μl wxya 2 o

up to 20μl

[0092] Reaction program: 94°C: 3min; 94°C: 30sec; 58°C: 45sec; 72°C: 1kb / 30s; 33cycles; 72°C: 10min; 16°C: forever.

[0093] A small fragment (PgbHLH149 gene fragment) was recovered.

[0094] 3. The target gene is connected to the target vector:

[0095] PgbHLH149 gene overexpression vector construction scheme, the map of the PgbHLH149 gene overexpression vector see Figure 5 .

[0096] (1) Digest plasmid pCAMBIA2300-GFP with SacI and BamHI to recover...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a ginseng PgbHLH149 transcription factor and application thereof, and relates to the field of plant transcription factors. Through the screening test of effective exogenous substances for alleviating the iron toxicity stress of ginseng, this application found that adding an appropriate amount of silicon element under iron toxicity stress can effectively relieve the iron toxicity symptoms of ginseng. Combining the results of transcriptome and elemental analysis, this application discovered the bHLH transcription factor family A new transcription factor, PgbHLH149 transcription factor, showed a significant negative correlation between the expression of PgbHLH149 gene and the iron accumulation in ginseng, that is, the higher the expression of PgbHLH149 gene, the lower the iron accumulation in ginseng. The experiment of transgenic Arabidopsis with PgbHLH149 showed that the overexpression of PgbHLH149 gene in Arabidopsis can improve the resistance of transgenic plants to iron toxicity stress.

Description

technical field [0001] The invention relates to the field of plant transcription factors, in particular to a PgbHLH149 transcription factor and its application. Background technique [0002] Ginseng is a perennial herb of the Araliaceae genus Panax. It is a precious Chinese herbal medicine with high medicinal value and is known as the "King of Herbs". Jilin Province is the main production area of ​​ginseng in my country, and its output accounts for 80% of the country and 60-70% of the world. The ginseng cultivation industry plays a pivotal role in the agricultural economy of Jilin Province. Erythroderma is a common physiological disease of ginseng roots, which mainly causes reddish-brown plaques on the periderm of ginseng roots, and the lesion will gradually expand with the increase of ginseng age, resulting in a decline in the commercial grade of ginseng. In areas such as Fusong, Jilin Province, the incidence rate in some plots is sometimes as high as 80%, causing huge eco...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N5/10A01H5/00A01H5/10A01H6/20
CPCC07K14/415C12N15/8271
Inventor 王秋霞马莹莹金桥马琳张淋淋邵财孙海李美佳张舒娜刘政波
Owner INST OF SPECIAL ANIMAL & PLANT SCI OF CAAS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More