Supercharge Your Innovation With Domain-Expert AI Agents!

Application of ccdc157 gene and its mutant gene as molecular markers in the diagnosis of male infertility

A technology of CCDC157 and CCDC157-MIF515, which is applied in the fields of biomedicine and gene mutation diagnosis, and can solve the problems of unclear biological functions and related molecular mechanisms

Active Publication Date: 2021-06-04
ZHEJIANG UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CCDC157 has only been reported to be an important factor in the fusion of the transport carrier and the Golgi apparatus, but its biological function and related molecular mechanism are still unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of ccdc157 gene and its mutant gene as molecular markers in the diagnosis of male infertility
  • Application of ccdc157 gene and its mutant gene as molecular markers in the diagnosis of male infertility
  • Application of ccdc157 gene and its mutant gene as molecular markers in the diagnosis of male infertility

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1 Screening of patients with CCDC157-MIF515 mutation gene in patients with asthenozoospermia and their semen analysis

[0027] 1) This study was approved by the Ethics Committee of the Obstetrics and Gynecology Hospital Affiliated to Zhejiang University School of Medicine and informed consent was obtained from the patients. The semen of 50 patients with asthenozoospermia was collected in the Obstetrics and Gynecology Hospital Affiliated to Zhejiang University School of Medicine, and patients with organic lesions of the reproductive system, untreated endocrine disorders, drug or alcohol abuse within two years, chromosome, and AZF abnormalities were excluded Patients with semen abnormalities due to known causes such as , cryptorchidism, or mumps.

[0028] Asthenospermia patients masturbated to extract sperm, and used TIANamp Micro DNA Kit to extract the patient's semen DNA (according to the sixth item of the instruction manual - extraction of genomic DNA from micr...

Embodiment 2

[0040] Embodiment 2, the acquisition of CCDC157 knockout mice

[0041] 1) Using CRISPR / Cas9 technology, design 2 sgRNA sequences targeting the CCDC157 gene (the number in the NCBI database is 216516) through the CRISPR online website (http: / / crispr.mit.edu). The design strategy is as follows figure 2 As shown in A, gRNA1 (SEQ ID NO.12): CTCTGAGAGCGGCCTATGGTGGG; gRNA2 (SEQ ID NO.13): GGGAGGATCCATCCAACCTAGGG (both gRNAs are antisense strands of matching genes). After synthesis and annealing, it was connected to the pX458 vector expressing Cas9 protein.

[0042] 2) The pX458 vector was transferred into embryonic stem cells, which were screened by flow cytometry and then transferred to culture dishes for 24 hours. After the culture was completed, single clone selection and genotype identification were carried out.

[0043] 3) Mate C57BL / 6N female mice that were superovulated by hormone treatment with wild-type male mice in advance to obtain a large number of blastocyst cells (s...

Embodiment 3

[0060] Example 3 CCDC157 Gene Knockout Causes Infertility in Male Mice

[0061] 1) Observe and count CCDC157 - / - Mice and CCDC157 + / + growth and development of mice. The results showed that CCDC157 - / - Mice with CCDC157 + / + Survival rate of mice, appearance (such as figure 2 F) and no difference in overall behavior; male CCDC157 - / - Mice are completely sterile, female CCDC157 - / -The fertility of the mice was not affected. The above results indicate that CCDC157 knockout mice cause male sterility.

[0062] 2) Take 3 male CCDC157 - / - Mice were mated with several female wild-type mice for 3 months. During mating, the reproductive tract of female wild-type mice was observed for the presence of sperm plugs. The results were as follows: there were sperm plugs in the genital tract of female wild-type mice, which indicated that the mating was normal; but no offspring were born.

[0063] The above results indicated that CCDC157 gene knockout affected the fertilization proce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides the application of the CCDC157 gene and its mutation gene as molecular markers in the diagnosis of male infertility diseases. Experiments have shown that the CCDC157‑MIF515 mutant gene / protein leads to male infertility, spermatogenesis disorders, sperm dysfunction, reduced sperm count, reduced sperm motility, abnormal sperm morphology, and deformed sperm heads. The CCDC157‑MIF515 mutant gene / protein of the present invention can be used as a target gene for diagnosing male infertility. At the same time, the expression level of CCDC157 of CCDC157 gene / protein is significantly reduced in NOA patients and SCOS patients, and male infertility can be prevented and / or treated by increasing the activity and / or expression of CCDC157 protein.

Description

technical field [0001] The present invention belongs to the field of biomedicine, more specifically, belongs to the field of gene mutation diagnosis, and specifically relates to a kit for diagnosing male infertility caused by CCDC157 mutation nucleotide sequence or amino acid sequence. Background technique [0002] About 15% of couples in the world have infertility problems, of which male factors account for 50%, and there is an increasing trend year by year. Male infertility has brought a heavy burden to individuals, families and society. The etiology of male infertility is complex, including reproductive system anatomical structure and functional factors, infection factors, endocrine immune factors, genetic factors, mental and psychological factors and so on. Testicular spermatogenesis dysfunction caused by gene defects accounts for about 10%-15% of male infertility, and the main clinical manifestation is oligoasthenospermia (OAT) or azoospermia (azoospermia). Some patien...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6883G01N33/68A61K45/00A61P15/08
CPCC12Q1/6883G01N33/6893A61K45/00A61P15/08C12Q2600/156G01N2800/367G01N2333/47G01N33/689G01N33/6818
Inventor 席咏梅郑慧梅李晨杨小杭李景平张峰彬梁忠炎吴敬根苑鑫侯佳汝朱鑫海邓寰
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More