Chimeric antigen receptor T cells and application thereof

A chimeric antigen receptor and cell technology, applied in the field of biomedicine, can solve the problems of inability to recruit peripheral blood immune cells into the tumor, and inability to secrete exogenous IL-7 protein

Inactive Publication Date: 2021-01-05
汤朝阳
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] CN109504660A discloses a fourth-generation CAR-T cell and its construction method and application. The CAR includes an extracellular antigen binding region, a hinge region, an intracellular signal transduction region, and a cytokine signal region, wherein the extracellular antigen The binding region targets the two spatial epitopes of the Nectin-4 antigen, and the cytokine signaling region is IL7 and CCL19, but exogenous IL-7 protein cannot be secreted outside T cells, and the continuous secretion of CCL19 cannot maximize the Problems with peripheral blood immune cell recruitment into tumor interiors

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor T cells and application thereof
  • Chimeric antigen receptor T cells and application thereof
  • Chimeric antigen receptor T cells and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] The preparation of embodiment 1 lentiviral vector

[0057] Whole-gene synthesis of the following nucleic acid molecules:

[0058] ① A CAR molecule (SEQ ID NO: 2) formed by tandem nucleic acid sequences of GM-CSF signal peptide, MUC1 scFv, CD28 transmembrane domain, CD28 intracellular domain, CD3ζ, and TLR2;

[0059] ② A nucleic acid molecule formed in series by the nucleic acid sequences of IL-7 signal peptide (SEQ ID NO: 7) and IL-7 (without IL-7 signal peptide) (SEQ ID NO: 4);

[0060] ③ CCL19 nucleic acid molecule (SEQ ID NO: 6);

[0061] ④ A secreted IL-7 molecule formed by tandem nucleic acid sequences of IL-2 signal peptide (SEQ ID NO:3) and IL-7 (without IL-7 signal peptide) (SEQ ID NO:4);

[0062] ⑤ Regulatory CCL19 molecules formed in series by 4×NFAT-RE-minP promoter (SEQ ID NO:5) and CCL19 (SEQ ID NO:6);

[0063] SEQ ID NO: 7:

[0064] atgttccatgtttcttttaggtatatctttggacttcctcccctgatccttgttctgttgccagtagcatcatct.

[0065] The synthesized CAR molecule was c...

Embodiment 2

[0066] Embodiment 2 Preparation of recombinant lentivirus

[0067] (1) Cultivate 293T cells in a 10cm culture dish, the culture medium is DMEM high glucose medium+10%FBS (fetal bovine serum)+1% double antibody (100× penicillin-streptomycin mixed solution);

[0068] (2) When the 293T cell density in the culture dish reaches 80%, replace the medium with DMEM high glucose medium + 1% FBS + 1% double antibody;

[0069] (3) After replacing the medium and culturing for 2 hours, prepare a transfection reagent, take 500 μL opti-DMEM into a 15 mL centrifuge tube, add 7.2 μL of PEI (linear polyethyleneimine) with a concentration of 10 μg / μL, and mix slightly. Stand still for 5 minutes;

[0070] (4) Put 500 μL opti-DMEM into a 1.5 mL centrifuge tube, add the plasmid mixture shown in Table 1 into the centrifuge tube, mix well, add it to the transfection reagent, mix it upside down, and let it stand for 20 minutes;

[0071] Table 1

[0072] Reagent dose pWPXLd-expression ...

Embodiment 3

[0079] Example 3 Preparation of CAR-T cells expressing IL-7 and CCL19

[0080] (1) After sorting Pan T cells from umbilical cord blood, count the cells and adjust the concentration to 1×10 6 cells / mL, then add 10 μL of Miltenyi TransAct T cell reagent to each ml of cell suspension, and replace it with fresh medium (IMDM medium + 5% FBS (fetal bovine serum) + 1% double antibody ( 100×penicillin-streptomycin mixed solution)+IL-2);

[0081] (2) will 3×10 7 The activated T cells were centrifuged at 300g for 5min, and resuspended with 3mL medium (IMDM medium + 5% FBS (fetal bovine serum) + 1% double antibody (100 × penicillin-streptomycin mixed solution));

[0082] (3) Inoculate 3 mL of T cell suspension in a 6-well plate, 1 mL per well;

[0083] (4) Add the following recombinant lentivirus combinations to a 6-well plate, 9 mL per well;

[0084] ① Supernatant of recombinant lentivirus expressing CAR;

[0085] ② Equal amounts of recombinant lentivirus supernatant expressing CAR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides chimeric antigen receptor T cells and application thereof. An expression vector system for preparing the chimeric antigen receptor T cells comprises a first expression vector containing a chimeric antigen receptor coding gene, a second expression vector containing a signal peptide IL-2 coding gene and an IL-7 coding gene and a third expression vector containing a NFAT regulating and controlling type promoter and a CCL19 coding gene; the NFAT regulating and controlling type promoter comprises a NFAT regulating and controlling sequence and a promoter sequence; and the NFATregulating and controlling sequence comprises a nucleic acid sequence shown in SEQ ID NO:1. According to the Chimeric antigen receptor T cells and the application thereof, the signal peptide IL-7 isreplaced with a signal peptide of a T-cell secretory protein IL-2, the expression of the T cells to CCL19 is regulated and controlled by employing the NFAT regulating and controlling type promoter, and the secretory expression of the IL-7 by CAR-T cells and the regulated and controlled type expression of CCL19 by NFAT are achieved.

Description

technical field [0001] The invention belongs to the technical field of biomedicine, and relates to a chimeric antigen receptor T cell and an application thereof. Background technique [0002] Chimeric antigen receptor T cell (CAR-T) immunotherapy is to induce T cell activation by expressing a chimeric antigen receptor molecule that specifically recognizes and binds to tumor antigens on the T cell membrane, thereby achieving A technique for specifically killing tumor cells is one of the most promising tumor immunotherapies. [0003] At present, CAR-T immunotherapy has made great breakthroughs in the field of leukemia treatment, but there are still many problems in the treatment of solid tumors. Researchers have improved and optimized CAR-T therapy to improve the therapeutic effect of CAR-T on solid tumors. [0004] CN109504660A discloses a fourth-generation CAR-T cell and its construction method and application. The CAR includes an extracellular antigen binding region, a hi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/867C12N5/10A61K39/00A61P35/02
CPCC12N15/86C12N5/0636C07K16/3092C07K14/7051C07K14/5418C07K14/521A61K39/00117A61P35/02C12N2740/15043C07K2319/02C07K2319/03C07K2319/33C07K2319/036A61K2039/5158
Inventor汤朝阳秦乐吴迪魏志辉王翠花王艳艳其他发明人请求不公开姓名
Owner汤朝阳