A kind of Bacillus colloid and its application in agricultural production
A technology of Bacillus colloids and Bacillus, applied in the field of screening and application of functional microorganisms, can solve problems such as lack of biological control research, and achieve the effects of achieving agricultural health, improving quality, and preventing common plant diseases
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Separation and Screening of Phosphorus-Solubilizing Microorganisms in Soil
[0041] 1. Soil sample: grape rhizosphere soil in Daze Mountain, Pingdu, Qingdao, Shandong Province.
[0042] 2. Preparation of soil dilution:
[0043] Remove 5cm-10cm of surface plant residues and topsoil, and collect 10g samples from the soil at each sampling point using the method of multi-point collection, and put them into a sample bag. After drying in the shade, the soil sample was reduced to about 50g by the quartering method; then placed in a 500ml conical flask containing 250ml of sterile PB buffer; shaken at 30°C, 180rpm for 30min, left for precipitation, and the supernatant was taken; Take 100ml of supernatant, centrifuge at 12000rpm for 10min, take the precipitate; suspend the precipitate in 50ml sterile PB buffer and centrifuge again at 12000rpm for 10min; after repeating twice, suspend the precipitate in 10ml sterile water to prepare a soil suspension.
[0044] Take 0.1...
Embodiment 2A11
[0054] Example 2 Identification of strain A11
[0055] 1. Molecular biological identification
[0056] A single colony of A11 strain on the plate was picked and cultured in nutrient broth medium at 37° C. for 24 hours, and then 500 ul of the strain fermentation broth was taken and the genome of the strain was extracted using a kit. Using the genome as a template, primer sequences were designed, and the 16s rDNA sequence was amplified by PCR.
[0057] 1) Primer sequence:
[0058] A11F:AGGGTTTTGATCCTGGCTCC;
[0059] A11R: GGTGGATTCTTGTTACGACTT.
[0060] 2) Reaction system (50 μL)
[0061] Table 2 16s rDNA PCR amplification system
[0062]
[0063] 3) The 1% agarose gel electrophoresis pattern of PCR amplification products is as follows: figure 1 As shown, the length of the amplified 16s rDNA fragment is about 1500 bp, which is in line with the conventional 16s rDNA sequence length.
[0064] 4) PCR product sequencing
[0065] The amplified PCR products were sent to Sha...
Embodiment 3
[0072] Example 3 Determination of Potassium-Solubilizing Ability of Bacillus colloid LLH08
[0073] 3.1 Determination method
[0074] The potassium feldspar liquid medium was prepared, and 95mL was divided into 250mL conical flasks. The bacterial suspension of Bacillus glialis LLH08 was transferred into the shake flask at 5% of the inoculation amount, and three parallels were made at the same time, and a control group without inoculation was set, and the culture was shaken at 30° C. for 72 hours.
[0075] 3.2 Treatment of fermentation broth
[0076] Take 20 mL of fermentation broth from each shake flask, centrifuge at 4 °C and 5 000 r / min for 15 min; put all the centrifuged supernatant into a 50 mL digestion tube; add 5 mL of concentrated sulfuric acid and 2 mL of hydrogen peroxide solution for digestion Cook in the oven, and add 20% hydrogen peroxide solution several times until the viscous material is completely digested, and then dilute to 50 mL with distilled water. Use...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com