Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of Bacillus colloid and its application in agricultural production

A technology of Bacillus colloids and Bacillus, applied in the field of screening and application of functional microorganisms, can solve problems such as lack of biological control research, and achieve the effects of achieving agricultural health, improving quality, and preventing common plant diseases

Active Publication Date: 2022-07-19
QINGDAO LILIHUI BIOTECH
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] Bacillus colioids has been discovered for more than 100 years. People have done in-depth research on the application of this bacteria in microbial fertilizers, mineral decomposition and bioflocculation, and have made certain achievements. However, in terms of biological control research is still lacking

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Bacillus colloid and its application in agricultural production
  • A kind of Bacillus colloid and its application in agricultural production
  • A kind of Bacillus colloid and its application in agricultural production

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1 Separation and Screening of Phosphorus-Solubilizing Microorganisms in Soil

[0041] 1. Soil sample: grape rhizosphere soil in Daze Mountain, Pingdu, Qingdao, Shandong Province.

[0042] 2. Preparation of soil dilution:

[0043] Remove 5cm-10cm of surface plant residues and topsoil, and collect 10g samples from the soil at each sampling point using the method of multi-point collection, and put them into a sample bag. After drying in the shade, the soil sample was reduced to about 50g by the quartering method; then placed in a 500ml conical flask containing 250ml of sterile PB buffer; shaken at 30°C, 180rpm for 30min, left for precipitation, and the supernatant was taken; Take 100ml of supernatant, centrifuge at 12000rpm for 10min, take the precipitate; suspend the precipitate in 50ml sterile PB buffer and centrifuge again at 12000rpm for 10min; after repeating twice, suspend the precipitate in 10ml sterile water to prepare a soil suspension.

[0044] Take 0.1...

Embodiment 2A11

[0054] Example 2 Identification of strain A11

[0055] 1. Molecular biological identification

[0056] A single colony of A11 strain on the plate was picked and cultured in nutrient broth medium at 37° C. for 24 hours, and then 500 ul of the strain fermentation broth was taken and the genome of the strain was extracted using a kit. Using the genome as a template, primer sequences were designed, and the 16s rDNA sequence was amplified by PCR.

[0057] 1) Primer sequence:

[0058] A11F:AGGGTTTTGATCCTGGCTCC;

[0059] A11R: GGTGGATTCTTGTTACGACTT.

[0060] 2) Reaction system (50 μL)

[0061] Table 2 16s rDNA PCR amplification system

[0062]

[0063] 3) The 1% agarose gel electrophoresis pattern of PCR amplification products is as follows: figure 1 As shown, the length of the amplified 16s rDNA fragment is about 1500 bp, which is in line with the conventional 16s rDNA sequence length.

[0064] 4) PCR product sequencing

[0065] The amplified PCR products were sent to Sha...

Embodiment 3

[0072] Example 3 Determination of Potassium-Solubilizing Ability of Bacillus colloid LLH08

[0073] 3.1 Determination method

[0074] The potassium feldspar liquid medium was prepared, and 95mL was divided into 250mL conical flasks. The bacterial suspension of Bacillus glialis LLH08 was transferred into the shake flask at 5% of the inoculation amount, and three parallels were made at the same time, and a control group without inoculation was set, and the culture was shaken at 30° C. for 72 hours.

[0075] 3.2 Treatment of fermentation broth

[0076] Take 20 mL of fermentation broth from each shake flask, centrifuge at 4 °C and 5 000 r / min for 15 min; put all the centrifuged supernatant into a 50 mL digestion tube; add 5 mL of concentrated sulfuric acid and 2 mL of hydrogen peroxide solution for digestion Cook in the oven, and add 20% hydrogen peroxide solution several times until the viscous material is completely digested, and then dilute to 50 mL with distilled water. Use...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of functional microorganism screening and application, in particular to a novel Bacillus colloid and its application in agricultural production. The preservation number of the Bacillus colloid is CCTCC NO: M2020163, which can effectively improve soil fertility, promote crop growth, increase yield, and has a good effect on plant diseases such as apple ringworm, brown spot, and cucumber root knot nematode. Control effect, wide application prospects.

Description

technical field [0001] The invention relates to the technical field of screening and application of functional microorganisms, in particular to a Bacillus colloid and its application in agricultural production. Background technique [0002] Microbial fertilizer is a new type of fertilizer, also known as biological bacterial fertilizer, bacterial agent and bacterial fertilizer. A number of important microorganisms are included in microbial fertilizers. Microbial fertilizers have the advantages of reducing soil compaction, improving soil fertilizer retention capacity, enhancing the utilization rate of alkali-hydrolyzed nitrogen and other substances in the soil, increasing crop yield and improving quality. Compared with inorganic fertilizers and organic fertilizers, microbial fertilizers are fundamentally different, so it is impossible to replace all existing fertilizers with microbial fertilizers. [0003] As early as the 1950s, Soviet microbiologists discovered potassium-so...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/20C05F11/08C05G3/60C05G3/80A01N63/22A01P3/00A01P5/00C12R1/07
CPCC05F11/08C05G3/60C05G3/80A01N63/22C12R2001/07C12N1/205Y02A40/10
Inventor 代庆海孙春龙王丽宁李倩倩林俊荣王凌云
Owner QINGDAO LILIHUI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com