Primers and method for detecting single nucleotide polymorphism of GCKR gene by utilizing HRM technology

A technology for single nucleotide polymorphism and technical detection, which is applied in the field of primers and methods for detecting GCKR gene single nucleotide polymorphism by HRM technology, and can solve the problem of high requirements on reaction conditions, cumbersome test process, complicated operation process, etc. problems, to achieve high sensitivity and specificity, shorten the detection time, and achieve the effect of good repeatability

Pending Publication Date: 2021-02-12
杭州艾迪康医学检验中心有限公司
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

RFLP does not require high equipment, but the operation process is complicated, and false negative errors are prone to occur; AS-PCR has high requirements on primer design and PCR reaction conditions, and false positive errors are prone to occur; Sanger sequencing method has accurate results, but the test process is cumbersome. higher cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers and method for detecting single nucleotide polymorphism of GCKR gene by utilizing HRM technology
  • Primers and method for detecting single nucleotide polymorphism of GCKR gene by utilizing HRM technology
  • Primers and method for detecting single nucleotide polymorphism of GCKR gene by utilizing HRM technology

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The method for detecting the SNP site rs1260326 of the GCKR gene in the subject by using the high-resolution melting curve (HRM) method includes obtaining sample DNA and providing reagents required for sequencing. Refer to Example 2 for specific operation steps. The reagents include: Whole Blood Genomic DNA Extraction Kit (TIANGEN), HRM Detection Kit FP210-01 (Tiangen Biochemical Technology Co., Ltd., Beijing, China), primers for detecting rs1260326 site, and standard products. Among them, the primers for detecting the rs1260326 site are:

[0029] GCKR-F:GTGGAGCAGGTGAAAGAGAAG;

[0030] GCKR-R:ACCTGGGTCCCCTTTGTCAC.

[0031] Standard products are DNA samples of TT genotype, CC genotype and TC genotype; Negative control substance: solution without DNA.

[0032] Detection system PCR reaction solution includes:

[0033]

[0034] The PCR reaction procedure is:

[0035]

[0036]

[0037]The present invention also adopts the sequencing method to further verify the ...

Embodiment 2

[0047] The operation process of blood genomic DNA extraction kit (TIANGEN):

[0048] (1) Genomic DNA extraction from whole blood

[0049] 1) Add 20 μl proteinase K to the bottom of a 1.5ml centrifuge tube. .

[0050] 2) Add 200 μl of plasma to the centrifuge tube.

[0051] 3) Add 200 μl Buffer AL and shake for 15 seconds.

[0052] 4) Water bath at 56°C for 10 minutes, and then briefly centrifuge to remove the liquid on the inner edge of the centrifuge tube cover.

[0053] 5) Add 200 μl of ethanol (96%-100%), shake for 15 s, and briefly centrifuge to remove the liquid along the inner edge of the centrifuge tube cover.

[0054] 6) Carefully add the mixture (including the precipitate) obtained above to the QIAamp Mini spin column (without wetting the rim). Put the spin column into a 2ml collection tube, close the cap of the centrifuge tube tightly, and spin at 6000×g (8000rpm) Centrifuge for 1 min. Take out the centrifuge tube and put it into a clean 2ml collection tube (pr...

Embodiment 3

[0092] Embodiment 3 clinical sample detection

[0093] Take 20 cases of clinical samples to be tested, extract genomes, prepare reagents and detect according to the methods and reagents described in Examples 1 and 2.

[0094] Add each sample to the detection system PCR reaction solution 1μL . At the same time, make a copy of each standard product. Detect with a fluorescent PCR instrument, and the time is 120 minutes.

[0095] Such as figure 1 Shown are the HRM results for Standard TT, Standard CC, and Standard TC.

[0096] Such as figure 2 Shown are the HRM results of 20 clinical samples and standards.

[0097] According to the HRM results, the genotypes of the rs1260326 loci of the GCKR gene in 20 screening samples were interpreted as shown in Table 1 below.

[0098] Table 1

[0099]

[0100]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to detecting GCKR gene single nucleotide polymorphism site rs1260326 in a body of a patient suffering from non-alcoholic fatty liver disease infection related diseases, and discloses an amplification primer and a detection method are used for detecting single nucleotide polymorphism of the GCKR gene by utilizing an HRM technology. The method is simple and convenient to operate, high in detection speed, high in flux, low in cost, high in sensitivity and specificity, good in repeatability and convenient in result interpretation. The amplification primer and the detection method are helpful for early discovery, early diagnosis and early treatment of clinical non-alcoholic fatty liver disease related diseases, and have important significance for timely intervening treatment to avoid disease progression, adjusting a treatment scheme, predicting prognosis and preventing clinical recurrence.

Description

technical field [0001] This patent relates to a gene polymorphism detection method for clinical testing. HRM technology is used to detect the SNP site rs1260326 of the GCKR gene in NAFLD patients, and at the same time, it can accurately screen high-risk groups. The method can effectively save detection time and cost and improve detection accuracy. [0002] technical background [0003] Non-alcoholic fatty liver disease (NAFLD) is a metabolic stress-induced liver injury closely related to insulin resistance (insulin resistance, IR) and genetic susceptibility. Fatty liver (non-alcoholic simple fatty liver, NAFL), non-alcoholic steatohepatitis (NASH) and related liver cirrhosis and hepatocellular carcinoma (hepatocellular carcinoma, HCC). In developed countries, NAFLD affects one-third of adults and a growing number of children, and has received wide attention. In my country, NAFLD has replaced chronic hepatitis B as the largest chronic liver disease, and the prevalence rate o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/6883C12Q1/6858C12N15/11
CPCC12Q1/6883C12Q1/6858C12Q2600/156C12Q2600/172C12Q2600/118C12Q2600/106C12Q2527/107C12Q2531/113
Inventor裘振亚王淑一
Owner杭州艾迪康医学检验中心有限公司