Supercharge Your Innovation With Domain-Expert AI Agents!

Protein for improving pathogenic bacteria resistance of sturgeons as well as preparation method and application thereof

A protein and sturgeon technology, applied in the field of protein engineering, can solve problems such as drug residues in the water environment, pathogen drug resistance, affecting the quality of aquatic products and human health

Active Publication Date: 2021-03-12
BEIJING FISHERIES RES INST
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] At present, drug prevention and control is the main measure for the treatment of aquatic diseases. In the disease prevention and control technology of sturgeon, the common method is to directly add finished antibiotics to the processed feed. Although the drugs can prevent and control diseases to a certain extent in a short period of time, but It will also bring some disadvantages, such as long-term frequent use of antibiotics and some other chemical drugs will cause drug resistance of pathogens, drug residues in fish and pollution of water environment, etc., also affect the quality of aquatic products and human health

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Protein for improving pathogenic bacteria resistance of sturgeons as well as preparation method and application thereof
  • Protein for improving pathogenic bacteria resistance of sturgeons as well as preparation method and application thereof
  • Protein for improving pathogenic bacteria resistance of sturgeons as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1 Determination and cloning of differentially expressed genes with changes in immune function under different conditions

[0038] In order to study whether conditions such as immunogen stimulation or high temperature stress affect the immune function of sturgeon, the inventor's team has sequenced the liver transcriptome of sturgeon under different conditions. expressed genes.

[0039] The primers were designed according to the sequence, and the Siberian sturgeon spleen cDNA was used as the template to amplify the partial fragment of the cDNA. Specific primers GSPI, NP3, GSPII and NP5 were designed according to the obtained cDNA fragment sequence for RACE assay.

[0040] Abirp-GSP5-1:5'-CCGCTGCAGGACAGGAAGTAATTAC-3'; SEQ ID NO. 7

[0041] Abirp-GSP5-2: 5'-TGTAGGTGGAGATGAGGGGAGTCACT-3'; SEQ ID NO. 8

[0042] Abirp-GSP3-1:5'-TAACGGAAGAAAGGACCCAAGACGCG-3'; SEQ ID NO. 9

[0043] Abirp-GSP3-2: 5'-ATAAGGAGATCTGTGATGAACTCAGA-3'; SEQ ID NO. 10

[0044] The total RNA ...

Embodiment 2

[0045] Example 2 Preparation of Siberian sturgeon IRP recombinant protein

[0046] 1. Cloning of Siberian sturgeon IRP mature peptide: According to the gene sequence obtained in Example 1, the SignalPv5.0 Server software was used to analyze the signal-free peptide online, and the Siberian sturgeon spleen cDNA was used as a template to design with NcoI and HindIII restriction sites respectively. The primers F(F:C CCATGGCTCTGCAGCCTCTCGACATC, SEQ ID NO. 5) and R (R: CC AAGCTT CTAAACAGGGGGGGC, SEQ ID NO. 6) was subjected to PCR amplification to amplify the cDNA fragment of the Siberian sturgeon IRP mature peptide of amino acids 3-143.

[0047] The 25μL reaction system contains 2.5μL 10×Ex buffer, 2μL dNTP, 0.3μmol F and R primers each, 1U Extaq enzyme (Takara), 500ng cDNA template, PCR reaction program: 94℃ for 10min; 94℃ for 25s, 52℃ for 25s, 72°C for 30s (10 cycles); 94°C for 25s, 60°C for 25s, 72°C for 30s (25 cycles); 72°C for 7min. After analysis by 1% agarose gel elect...

Embodiment 3

[0068] Example 3 Expression characteristics of Abirp in different tissues of Siberian sturgeon

[0069] Real-time quantitative PCR was used to detect the relative expression of Abirp in different tissues of healthy Siberian sturgeon, and to study the tissue distribution of AbirpmRNA.

[0070] Specific operation method: randomly select 11 tissues of 10 healthy Siberian sturgeon (weight about 150g) of 10 1-year-old males and half, respectively: blood, gills, eyes, head kidney, spleen, heart, muscle, skin, liver, brain and intestines. Total RNA was extracted by Trizol method and reverse transcribed into cDNA by Takara reverse transcription kit.

[0071] According to the cDNA sequence of Abirp, the primers for fluorescence quantitative PCR were designed. The primer sequences are as follows:

[0072] AbirpF: 5'-GCCCAACTCACCCGTCCT-3';

[0073] AbirpR: 5'-GGTTTATGTTGCTGTCTCGCTTGT-3';

[0074] The primer sequences of the internal reference gene 18S rRNA are as follows:

[0075] 1...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a protein for improving pathogenic bacteria resistance of sturgeons as well as a preparation method and an application thereof. The amino acid sequence of the protein capableof improving the pathogenic bacteria resistance of sturgeons provided by the invention is as shown in SEQ ID NO. 2. The liver transcriptomes of sturgeons under different conditions are sequenced, a segment of differentially expressed genes with changed immune functions under different conditions is found according to sequencing results, total RNA of sturgeon spleen is extracted, an RACE technologyis adopted for splicing to obtain a recombinant protein AbIRP with the cDNA sequence overall length shown in SEQ ID NO.1, and the recombinant protein AbIRP is obtained through a recombinant expression technology, tests find that the injected recombinant protein AbIRP has remarkable clearing and inhibiting effects on sturgeon infected pathogenic bacteria, can be used as an immunologic adjuvant toimprove the immune effect of the vaccine, and can be used as a feed additive to improve the disease resistance of the hybrid sturgeon to the pathogenic bacteria.

Description

technical field [0001] The invention relates to the technical field of protein engineering, in particular to a protein for improving the ability of sturgeon to resist pathogenic bacteria and a preparation method and application thereof. Background technique [0002] Sturgeon is a cartilaginous scaly species, which is easy to domesticate, grows fast, and has high economic value. It is an important aquaculture species in my country. In recent years, with the expansion of the scale of sturgeon farming, high-density farming often leads to frequent occurrence of diseases, which brings huge losses to the aquaculture industry. During the whole sturgeon breeding period, the most harmful and deadly diseases were mainly sturgeon septicemia caused by Aeromonas hydrophila and mixed enteritis caused by Aeromonas mildew. [0003] At present, drug prevention and control is the main measure for the treatment of aquatic diseases. In the disease prevention and control technology of sturgeon,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/46C12N15/12C12N15/70C12N15/66A61K38/17A61K39/39A61P37/04A61P31/04A23K50/80A23K20/147A23K20/195A23K20/153
CPCC07K14/461C12N15/70C12N15/66A61K39/39A61P37/04A61P31/04A23K50/80A23K20/147A23K20/195A23K20/153A61K38/00A61K2039/55516Y02A40/81
Inventor 王晓雯朱华胡红霞张蓉刘丽丽
Owner BEIJING FISHERIES RES INST
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com