Shewanella with graphene affinity and construction method and application thereof
A technology of Shewanella and construction method, applied in the field of genetic engineering, to achieve the effect of great application potential and development value, highlighting electron transfer and utilization efficiency, and strong GO reduction ability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: Construct the recombinant Shewanella of extracellular MtrC protein affinity graphene
[0035] Extracellular cytochrome protein of Shewanella oneidensis MR-1 (Shewanella oneidensis MR-1, GenBanK: AE014299.2) according to NCBI database mtrC The gene (GenBanK: AAN54831.1) was codon-optimized, and the additional graphene affinity peptide domain EPLQLKM was translated into a nucleotide sequence, and the flexible polypeptide GSGGSG and mtrC The C-terminal connection of the gene, adding a soft sequence GS before the terminator, and finally constructing the gene fragment mtrC -EPLQLKM, its amino acid sequence is shown in SEQ ID NO.1, and its nucleotide sequence is shown in SEQ ID NO.2.
[0036] Amplification was designed using Primer Premier 5.0 software mtrC- A pair of primers for the EPLQLKM sequence, the forward primer sequences are respectively shown in SEQ ID NO.3, namely: TGATGAACGCACAAAAATCA and SEQ ID NO.4, namely: ATCGGGGTACCATGATGAACGCACAAAAATCA; there...
Embodiment 2
[0040] Embodiment 2: Fumaric acid bioelectrochemical detection of MtrC protein activity of recombinant Shewanella
[0041] In this example, the electrochemical performance measurement of the whole cell was performed on the recombinant Shewanella by using a three-electrode system. Take Shewanella MR-1 (△ mtrC ) and wild Shewanella as controls, the effect of the expression of MtrC protein in the electron transport chain of Shewanella on the electron transfer of the strain was detected by the reverse electron transfer detection method of Shewanella using fumaric acid as the electron donor. Determine whether the terminal electron transport protein MtrC can be highly expressed.
[0042] (1) Recombinant Shewanella and Shewanella MR-1 (△ mtrC ) and wild Shewanella bacteria were placed on LB solid medium for streak culture, and after a single colony grew out, a single colony was taken and placed in LB liquid medium for expansion for 12~16 hours (Note: Recombinant Shewanella culture ...
Embodiment 3
[0047] Embodiment 3: the GO reduction ability detection test of recombinant Shewanella, wild Shewanella
[0048] After the recombinant Shewanella obtained in Example 1 and the single colonies of wild Shewanella were expanded and cultivated in LB medium for 12-16h, the OD was adjusted in the M9 medium. 600 for 2. Graphene oxide (GO) at 2 mg / mL was prepared by conventional methods, and mixed with 1 mL of strain M9 suspension by adjusting the amount of GO added, and filled to 2 mL with M9 to ensure that the final concentration of GO in the mixture was 0.1 mg / mL , 0.15mg / mL, 0.2mg / mL, 0.25mg / mL;
[0049] Add 200 μL of the strain and GO mixture to a 96-well plate, and detect the absorbance A every 10 minutes 595 Value, and take pictures at different times (0h, 3h, 8h) to observe the reduction degree of GO.
[0050] Figure 5 is the visual map of GO reduction of wild Shewanella and recombinant Shewanella; Figure 5 It can be intuitively observed that brown GO is continuously re...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More