Pitaya gene HuAAE3 and application thereof in regulating and controlling high temperature stress resistance of plants

A dragon fruit, high temperature resistance technology, applied in the fields of application, plant products, genetic engineering, etc., can solve the problems affecting the growth and development of crops, affecting the yield of crops, etc., to achieve the effect of improving resistance and reducing safety hazards

Active Publication Date: 2021-05-14
SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The global greenhouse effect has caused global temperature to rise, and high temperature stress has seriously affected the growth and development of crops (Hasanuzzaman M., et al.Physiological, biochemical, and molecular mechanisms of heat stress tolerance in plants. International journal of molecular sciences, 2013, 14: 9643-9684) , thereby affecting the yield of crops (Lesk C., et al. Influence of extreme weather disasters on global crop production. Nature, 2016, 529: 84-87)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pitaya gene HuAAE3 and application thereof in regulating and controlling high temperature stress resistance of plants
  • Pitaya gene HuAAE3 and application thereof in regulating and controlling high temperature stress resistance of plants
  • Pitaya gene HuAAE3 and application thereof in regulating and controlling high temperature stress resistance of plants

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The construction of the overexpression vector of embodiment 1 HuAAE3 gene and the acquisition of transgenic material

[0047] The overexpression vector constructed by the present invention is pCAMBIA1302-AAE3, wherein the vector map of pCAMBIA1302 is as follows figure 1 As shown, the steps of constructing the vector and obtaining the transgenic material are as follows:

[0048] (1) Amplify the target gene: with the dragon fruit cDNA template containing the HuAAE3 gene, the upstream primer: 5'-TGACCATGGTAGATCTGATGGAGAGCTTGACTCTCA-3' (SEQ ID NO.4) and the downstream primer 5'-CTTCTCCTTTACTAGTAGCACCGAACTTGGGGA-3' (SEQ ID NO. 5) Amplify the 1372bp target fragment. The PCR reaction system is: 2× Max DNA Polymerase 12.5 μL, 10 μM upstream / downstream primers 0.75 μL each, cDNA template 1 μL, ddH 2 O 10 μL. The various components were mixed and placed on a PCR instrument for reaction. The PCR reaction program was as follows: 98°C for 5 min; 98°C for 10 s, 55°C for 15 s, 7...

Embodiment 2

[0056] Example 2 Comparison of overexpressed Arabidopsis and wild-type Arabidopsis treated at 45°C at high temperature

[0057] The wild-type Arabidopsis seeds and T2 homozygous overexpressed Arabidopsis seeds were surface-sterilized, sown on MS medium, placed at 4°C for three days for vernalization, and then placed at 22°C for 16h under white light (50 μmol / m 2 s) / 8h dark cycle greenhouse, after 7 days high temperature treatment at 45°C for 2h, the results are as follows Figure 4 and 5 As shown, it shows that the overexpression of HuAAE3 transgenic Arabidopsis lines is significantly higher than the survival rate of wild-type Arabidopsis, and it can be further found through the experimental results that the three HuAAE3-OX7, HuAAE3-OX16 and HuAAE3-OX18 transgenes in the experimental group There are still some differences in the survival rate of the strains after high temperature treatment, which may be related to the different overexpression folds of the HuAAE3 gene in dif...

Embodiment 3

[0058] Example 3 HuAAE3 gene expression pattern in pitaya under high temperature treatment at 45°C

[0059]In order to further study the response mode of HuAAE3 gene in dragon fruit to high temperature stress. The expression level of HuAAE3 gene in dragon fruit at different time points under high temperature stress was detected by qRT-PCR technology. Take dragon fruit leaves under high temperature treatment at 45°C for 24h, 48h and 72h for total RNA extraction, after reverse transcription, use the fluorescence quantitative kit Hieff TM qPCR Green Master Mix (No Rox) for qRT-PCR, qRT-PCR reaction system: 2×SYBR GreenMaster Mix 5 μL, 10 μM forward / reverse primer (AAE-Q-F: CGTCGCCCTCACCTACCCCA, SEQ ID NO.8; AAE-Q-R: CCGAGTCGCCGGAGGGAAGA, SEQ ID NO.9) each 0.2 μL, diluted cDNA 1 μL, ddH 2 O 3.6 μL. 384 wells were used for qRT-PCR, and the instrument was Light Cycler480 from RoChe Company. The following procedures were used: pre-denaturation at 95°C for 5 min; denaturation at...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a pitaya gene HuAAE3 and application thereof in regulating and controlling high temperature stress resistance of plants, the nucleotide sequence of the pitaya gene HuAAE3 is shown as SEQ ID NO.1 or is a sequence completely complementarily paired with the SEQ ID NO.1, and the coded amino acid sequence of the pitaya gene HuAAE3 is shown as SEQ ID NO.2. The invention further discloses a preparation method of the pitaya gene HuAAE3. Research finds that the oxalyl-coenzyme A synthetase AAE3 of the plant expressed by the dragon fruit HuAAE3 gene participates in heat stress response, which is of great significance to comprehensive understanding of biological functions of the oxalyl-coenzyme A synthetase AAE3 in the plant. Meanwhile, the HuAAE3 gene is over-expressed by the inventor through a transgenosis method, and along with the increase of the expression quantity of the HuAAE3 gene, the resistance of arabidopsis thaliana to high temperature is improved. Therefore, the dragon fruit HuAAE3 gene and the corresponding protein can be applied to genetic engineering genetic breeding of crops, high-temperature-resistant crop varieties are cultivated, safety hazards caused by high temperature to food crops are reduced, and the dragon fruit HuAAE3 gene and the corresponding protein have important reference significance for related research on high-temperature tolerance of other crops.

Description

technical field [0001] The invention relates to the field of plant genetic engineering, in particular to dragon fruit gene HuAAE3 and its application in regulating plant resistance to high temperature stress. Background technique [0002] Dragon fruit (Hylocereus spp.) is a plant of the genus Cactaceae, the genus Hylocereus or the genus Serpentine, and is a tropical and subtropical fruit tree. Pitaya originated in Mexico and the American continent, and then introduced into Vietnam, Thailand and other Southeast Asian countries and Taiwan Province of my country, and then introduced and planted in Hainan, Guangxi, Guangdong, Fujian and other provinces in mainland China (Xu Weidong et al. A preliminary report on the introduction of dragon fruit [J]. Fruit Trees in South China, 2002,31(1):33-34.). Dragon fruit has high economic value. The flowers, stems and fruits of dragon fruit are edible and ornamental, and the fruit has rich nutritional value. It is a characteristic plant int...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/52C12N9/00C12N15/84A01H5/00A01H6/20
CPCC12N9/93C12N15/8205C12N15/8271C12Y602/01008
Inventor夏快飞张明永徐卫娟贾永霞曾璇陈建通
OwnerSOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI