Pitaya gene HuAAE3 and application thereof in regulating and controlling high temperature stress resistance of plants
A dragon fruit, high temperature resistance technology, applied in the fields of application, plant products, genetic engineering, etc., can solve the problems affecting the growth and development of crops, affecting the yield of crops, etc., to achieve the effect of improving resistance and reducing safety hazards
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] The construction of the overexpression vector of embodiment 1 HuAAE3 gene and the acquisition of transgenic material
[0047] The overexpression vector constructed by the present invention is pCAMBIA1302-AAE3, wherein the vector map of pCAMBIA1302 is as follows figure 1 As shown, the steps of constructing the vector and obtaining the transgenic material are as follows:
[0048] (1) Amplify the target gene: with the dragon fruit cDNA template containing the HuAAE3 gene, the upstream primer: 5'-TGACCATGGTAGATCTGATGGAGAGCTTGACTCTCA-3' (SEQ ID NO.4) and the downstream primer 5'-CTTCTCCTTTACTAGTAGCACCGAACTTGGGGA-3' (SEQ ID NO. 5) Amplify the 1372bp target fragment. The PCR reaction system is: 2× Max DNA Polymerase 12.5 μL, 10 μM upstream / downstream primers 0.75 μL each, cDNA template 1 μL, ddH 2 O 10 μL. The various components were mixed and placed on a PCR instrument for reaction. The PCR reaction program was as follows: 98°C for 5 min; 98°C for 10 s, 55°C for 15 s, 7...
Embodiment 2
[0056] Example 2 Comparison of overexpressed Arabidopsis and wild-type Arabidopsis treated at 45°C at high temperature
[0057] The wild-type Arabidopsis seeds and T2 homozygous overexpressed Arabidopsis seeds were surface-sterilized, sown on MS medium, placed at 4°C for three days for vernalization, and then placed at 22°C for 16h under white light (50 μmol / m 2 s) / 8h dark cycle greenhouse, after 7 days high temperature treatment at 45°C for 2h, the results are as follows Figure 4 and 5 As shown, it shows that the overexpression of HuAAE3 transgenic Arabidopsis lines is significantly higher than the survival rate of wild-type Arabidopsis, and it can be further found through the experimental results that the three HuAAE3-OX7, HuAAE3-OX16 and HuAAE3-OX18 transgenes in the experimental group There are still some differences in the survival rate of the strains after high temperature treatment, which may be related to the different overexpression folds of the HuAAE3 gene in dif...
Embodiment 3
[0058] Example 3 HuAAE3 gene expression pattern in pitaya under high temperature treatment at 45°C
[0059]In order to further study the response mode of HuAAE3 gene in dragon fruit to high temperature stress. The expression level of HuAAE3 gene in dragon fruit at different time points under high temperature stress was detected by qRT-PCR technology. Take dragon fruit leaves under high temperature treatment at 45°C for 24h, 48h and 72h for total RNA extraction, after reverse transcription, use the fluorescence quantitative kit Hieff TM qPCR Green Master Mix (No Rox) for qRT-PCR, qRT-PCR reaction system: 2×SYBR GreenMaster Mix 5 μL, 10 μM forward / reverse primer (AAE-Q-F: CGTCGCCCTCACCTACCCCA, SEQ ID NO.8; AAE-Q-R: CCGAGTCGCCGGAGGGAAGA, SEQ ID NO.9) each 0.2 μL, diluted cDNA 1 μL, ddH 2 O 3.6 μL. 384 wells were used for qRT-PCR, and the instrument was Light Cycler480 from RoChe Company. The following procedures were used: pre-denaturation at 95°C for 5 min; denaturation at...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



