LAMP primer for detecting tigecycline high-level drug-resistant gene tet (X) and variant thereof and method thereof
A drug-resistant gene, tigecycline technology, applied in the field of genetic testing, can solve the problems of human health threats, the failure of antibiotics, and the difficulty of clinical treatment of multidrug-resistant bacteria, and achieve the effect of easy rapid identification and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1, Identification or Preparation of a Kit of Reagents for Identification or Auxiliary Identification of Tigecycline Resistance Genes
[0038] The set of reagents for identification or auxiliary identification of tigecycline resistance gene described in the present invention consists of single-stranded DNA named F3, single-stranded DNA named B3, single-stranded DNA named FIP and single-stranded DNA named BIP. strand DNA composition;
[0039] The nucleotide sequence of F3 is the DNA of SEQ ID No.1 in the sequence listing (ATGAAAAAAGCGGGATTGT);
[0040] The nucleotide sequence of B3 is the DNA of SEQ ID No.2 in the sequence listing (TCTTACCAGGTTCAAGCATAA);
[0041] The nucleotide sequence of the FIP is the DNA of SEQ ID No.3 in the sequence listing;
[0042] The nucleotide sequence of the BIP is the DNA of SEQ ID No.4 in the sequence listing.
[0043] In the set of reagents for identifying or assisting in identifying the tigecycline resistance gene, the F3, the B3...
Embodiment 2
[0044] The detection condition of embodiment 2 tigecycline resistance gene
[0045] 1. Extraction of tigecycline resistance gene DNA
[0046] Resuscitate the strain to be tested (see Table 1) carrying the tigecycline resistance gene, purify it, pick a single colony, and inoculate it in 2 mL of MHB liquid medium (purchased from Beijing Land Bridge Co., Ltd.), at 37°C Shake culture at 200rpm, cultivate overnight, collect the bacteria by centrifugation, and extract DNA by boiling to obtain the total DNA of the strain to be tested.
[0047] 2. LAMP detection method
[0048] Using the DNA in step 1 as a template and the primer composition in Example 1 as a primer, the amplification is performed according to the LAMP detection method.
[0049] LAMP reaction system: 1μl of genomic DNA of the analyte, 0.8M betaine (betaine), 180μmol / L hydroxynaphthol blue, 8mM MgSO4, 1.4mM dNTP each, 8U Bst DNApolymerase, 0.2μM SEQ ID NO: 1 and SEQ ID NO : primers shown in 2, primers shown in 1.6 μ...
Embodiment 3
[0052] Embodiment 3, detect the specificity of the primer combination of tigecycline resistance gene
[0053] 1. Detection of four different tigecycline resistance genes LAMP
[0054] According to the method in Example 1, the DNA in the strains in Table 1 were respectively extracted, and distilled water was used as a negative control sample, and the LAMP detection was performed according to the method in Example 2. Test results such as figure 1 as shown, figure 1 The results in showed that the detection results of the tigecycline-resistant gene tet(X) and its homologous genes tet(X2), tet(X3), and tet(X4) were all sky blue, while the control sample used as a negative control 1, the test results of control sample 2, control sample 3 and water are all purple, show that the primer composition of the present invention can effectively and accurately detect tigecycline drug-resistant gene tet (X) and its homologous gene tet (X2), tet (X3), tet (X4).
[0055] In order to further ...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com