LAMP primer for detecting tigecycline high-level drug-resistant gene tet (X) and variant thereof and method thereof

A drug-resistant gene, tigecycline technology, applied in the field of genetic testing, can solve the problems of human health threats, the failure of antibiotics, and the difficulty of clinical treatment of multidrug-resistant bacteria, and achieve the effect of easy rapid identification and high sensitivity

Inactive Publication Date: 2021-06-22
CHINA AGRI UNIV
View PDF7 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, with the successive discovery and outbreak of carbapenem-resistant CRE and polymyxin-resistant bacteria, these antibacterial drugs are facing the risk of failure; resulting in tigecycline becoming the only treatment for multi-drug resistance. Bacterial infection "last line of defense" drugs
What's more serious is that the genes tet(X3) and tet(X4) that can mediate high levels of resistance to tigecycline were discovered and reported in previous studies (He T, Wang R, Liu D, et al.Emergence of plasma -mediated high-level tigecycline resistance genes in animals and humans[J].Nature microbiology,2019:1.), this type of gene has broken through the barrier of species transmission, and there is a risk of rapid epidemic, which indicates that tigecycline is the line of defense The failure of the system will inevitably increase the difficulty of clinical treatment of multi-drug resistant bacteria and pose a great threat to human health.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • LAMP primer for detecting tigecycline high-level drug-resistant gene tet (X) and variant thereof and method thereof
  • LAMP primer for detecting tigecycline high-level drug-resistant gene tet (X) and variant thereof and method thereof
  • LAMP primer for detecting tigecycline high-level drug-resistant gene tet (X) and variant thereof and method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1, Identification or Preparation of a Kit of Reagents for Identification or Auxiliary Identification of Tigecycline Resistance Genes

[0038] The set of reagents for identification or auxiliary identification of tigecycline resistance gene described in the present invention consists of single-stranded DNA named F3, single-stranded DNA named B3, single-stranded DNA named FIP and single-stranded DNA named BIP. strand DNA composition;

[0039] The nucleotide sequence of F3 is the DNA of SEQ ID No.1 in the sequence listing (ATGAAAAAAGCGGGATTGT);

[0040] The nucleotide sequence of B3 is the DNA of SEQ ID No.2 in the sequence listing (TCTTACCAGGTTCAAGCATAA);

[0041] The nucleotide sequence of the FIP is the DNA of SEQ ID No.3 in the sequence listing;

[0042] The nucleotide sequence of the BIP is the DNA of SEQ ID No.4 in the sequence listing.

[0043] In the set of reagents for identifying or assisting in identifying the tigecycline resistance gene, the F3, the B3...

Embodiment 2

[0044] The detection condition of embodiment 2 tigecycline resistance gene

[0045] 1. Extraction of tigecycline resistance gene DNA

[0046] Resuscitate the strain to be tested (see Table 1) carrying the tigecycline resistance gene, purify it, pick a single colony, and inoculate it in 2 mL of MHB liquid medium (purchased from Beijing Land Bridge Co., Ltd.), at 37°C Shake culture at 200rpm, cultivate overnight, collect the bacteria by centrifugation, and extract DNA by boiling to obtain the total DNA of the strain to be tested.

[0047] 2. LAMP detection method

[0048] Using the DNA in step 1 as a template and the primer composition in Example 1 as a primer, the amplification is performed according to the LAMP detection method.

[0049] LAMP reaction system: 1μl of genomic DNA of the analyte, 0.8M betaine (betaine), 180μmol / L hydroxynaphthol blue, 8mM MgSO4, 1.4mM dNTP each, 8U Bst DNApolymerase, 0.2μM SEQ ID NO: 1 and SEQ ID NO : primers shown in 2, primers shown in 1.6 μ...

Embodiment 3

[0052] Embodiment 3, detect the specificity of the primer combination of tigecycline resistance gene

[0053] 1. Detection of four different tigecycline resistance genes LAMP

[0054] According to the method in Example 1, the DNA in the strains in Table 1 were respectively extracted, and distilled water was used as a negative control sample, and the LAMP detection was performed according to the method in Example 2. Test results such as figure 1 as shown, figure 1 The results in showed that the detection results of the tigecycline-resistant gene tet(X) and its homologous genes tet(X2), tet(X3), and tet(X4) were all sky blue, while the control sample used as a negative control 1, the test results of control sample 2, control sample 3 and water are all purple, show that the primer composition of the present invention can effectively and accurately detect tigecycline drug-resistant gene tet (X) and its homologous gene tet (X2), tet (X3), tet (X4).

[0055] In order to further ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a LAMP primer for detecting tigecycline high-level drug-resistant genes tet (X) and variants thereof and a method thereof, and a complete set of primers for identification or auxiliary identification of tigecycline drug-resistant genes consists of a single-stranded DNA named F3, a single-stranded DNA named B3, a single-stranded DNA named FIP and a single-stranded DNA named BIP. The primer group disclosed by the invention can effectively and accurately detect tigecycline drug-resistant genes tet (X), tet (X2), tet (X3) and tet (X4), and the method has the advantages that the detection result is intuitive and visual, so that the method is convenient to quickly distinguish and can be applied on site; meanwhile, the sensitivity of the detection method disclosed by the invention is obviously 10-100 times higher than that of a conventional PCR detection method.

Description

technical field [0001] The invention belongs to the technical field of gene detection, and relates to a universal LAMP (loop-mediated isothermal amplification PCR) primer for polymyxin drug-resistant genes tet(X), tet(X2), tet(X3), and tet(X4) and detection methods. Background technique [0002] The widespread use of antibacterial drugs has led to the emergence and spread of bacterial resistance, which involves many fields such as animal husbandry, food, environment and hygiene, and has become a major threat to global public health security. According to the World Health Organization (WHO), bacterial resistance has become one of the greatest threats to human health in the 21st century. Countries around the world have successively issued a number of national plans in order to explore effective prevention and control measures and solve scientific problems related to the prevention and control of drug resistance. [0003] In recent years, with the prevalence of multidrug-resi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/689C12Q1/6844C12Q1/04C12N15/11C12R1/37C12R1/01
CPCC12Q1/689C12Q1/6844C12Q2600/106C12Q2531/119
Inventor汪洋刘志海刘德俊翟卫帅宋黄威吴聪明沈建忠
OwnerCHINA AGRI UNIV