GLP-1R/GIPR dual-target agonist fusion protein as well as preparation method and application thereof

A GLP-1R, fusion protein technology, applied in the field of biopharmaceuticals, can solve the problems such as no reports related to dual-target agonist fusion proteins, avoid downstream denaturation and renaturation processing, high hypoglycemic activity, hypoglycemic long-lasting effect

Active Publication Date: 2021-07-23
CHINA PHARM UNIV
View PDF15 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] There is no report on GLP-1R / GIPR dual-target agonist fusion protein

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GLP-1R/GIPR dual-target agonist fusion protein as well as preparation method and application thereof
  • GLP-1R/GIPR dual-target agonist fusion protein as well as preparation method and application thereof
  • GLP-1R/GIPR dual-target agonist fusion protein as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Example 1 Design of GLP-1R / GIPR dual-target agonist long-acting fusion protein

[0040] GLP-1R / GIPR dual-target agonist long-acting fusion protein structure such as figure 1 As shown, from the N-terminal to the C-terminal, it consists of the following polypeptide domains in series: highly active exenatide mutant (EX-L21K), Gly-rich linker peptide (GGGGS) 3, human glucose-dependent insulinotropic polypeptide (GIP) mutant (GIP-A2G), Gly-rich connecting peptide (GGGGS) 3, optimized mutant human IgG1 hinge region DKTHTCPPCP (underlined), human IgG1 constant region CH2-CH3.

[0041] Among them, the highly active exenatide mutant EX-L21K was obtained by mutating the 21st position of wild-type exenatide from Leu to Lys.

[0042] The GIP mutant GIP-A2G was obtained by mutating the second Ala of natural GIP to Gly.

[0043] The hinge region of optimized mutated human IgG1: has the amino acid sequence shown in -DKTHTCPPCP- (SEQ ID NO: 8).

[0044] Human IgG1 constant region CH...

Embodiment 2

[0046] Example 2 Cloning and expression of GLP-1R / GIPR dual-target agonist long-acting fusion protein

[0047] (1) Construction of recombinant plasmid pET27b-IgG1Fc

[0048] Using the plasmid containing the human IgG1Fc coding gene (SEQ ID NO: 16) synthesized in the laboratory as a template, design the following forward and reverse primers (the underlines indicate the restriction sites of BamH I and HindIII respectively):

[0049] BamHI-IgG1Fc-F: AATT GGATCC GGTGGTGGTGGTTCTGACAAAACCCACACCTGC (SEQ ID NO: 17);

[0050] HindIII-IgG1Fc-R: GGCCGC AAGCTT CTATTATTTACCCGGA (SEQ ID NO: 18).

[0051] The above primers were synthesized by Nanjing GenScript Biotechnology Company.

[0052] The IgG1Fc gene fragment was amplified by PCR technology, digested with BamH I and Hind III, and inserted into the corresponding restriction site of the expression vector pET27b to obtain the recombinant plasmid pET27b-IgG1Fc containing the gene encoding human IgG1Fc.

[0053] (2) Construction of ...

Embodiment 3

[0058] Embodiment 3 fusion protein EX-L21K-GIP-Fc engineering bacteria fermentation and separation and purification

[0059] (1) Preparation of seed solution

[0060] Glycerol tubes were used to pick up the bacterial liquid, and two three-section line cultures were carried out on the LBK culture plate. Pick a single colony from the LBK plate, insert it into 30mL LBK liquid medium, and cultivate it at 37°C and 220rpm for about 12h. This is the primary seed solution. Transfer the primary seed solution to two 500mL Erlenmeyer flasks with 100mL LBK liquid medium at 37°C with an inoculum size of 2% (v / v), and cultivate it at 220rpm for 12h. This is the secondary seed solution for high-density fermentation ,

[0061] (2) Fed-batch fermentation

[0062] The secondary seed solution was inserted with 4% (v / v) inoculum amount containing 4.5L fermentation medium (yeast powder 2.4% (w / v), tryptone 1.2% (w / v), glycerol 0.4% ( v / v), 17mM KH2PO4, 72mM K2HPO4 3H 2 O, defoamer 0.1% (v / v),...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a long-acting fusion protein with dual activation activity on a glucagon-like peptide-1 (GLP-1) receptor (GLP-1R) and a glucose-dependent insulinotropic polypeptide (GIP) receptor (GIPR), as well as a preparation method and application of the long-acting fusion protein. The fusion protein is formed by sequentially connecting three structural functional domains, namely exendin-4 or a mutant thereof, human glucose-dependent insulinotropic polypeptide (GIP) or a mutant thereof and an Fc fragment of human immunoglobulin IgG through a linker or directly connecting the three structural functional domains from an N-terminal to a C terminal. The invention also provides a genetic engineering preparation method for soluble expression of the fusion protein in escherichia coli. The method is simple in process, and protein products with biological activity can be conveniently and directly obtained from cell wall breaking liquid through purification. The fusion protein disclosed by the invention has remarkable dual agonist activity on GLP-1R and GIPR, and can be applied to preparation of medicines for treating diabetes, obesity, hyperlipidemia and other related diseases.

Description

technical field [0001] The invention belongs to biopharmaceutical technology, and specifically relates to a GLP-1R / GIPR dual-target agonist fusion protein and its preparation method, as well as its application in the preparation of medicines for treating diabetes, obesity, hyperlipidemia and other related diseases. Background technique [0002] Diabetes mellitus (DM) is an endocrine and metabolic disease characterized by hyperglycemia, mainly caused by defects in insulin secretion and / or insufficient insulin action. Diabetes can be divided into type 1 (Type 1 diabetes mellitus, T1DM) and type 2 (Type 2 diabetes mellitus, T2DM). Among them, T1DM does not produce insulin and is an insulin-dependent disease, while T2DM is mainly due to the body's insensitivity to insulin, resulting in insulin resistance, accounting for more than 90% of diabetic patients. Diabetes can lead to a variety of fatal complications, such as obesity, cardiovascular disease, kidney disease, etc., which ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70A61K38/22A61K47/68A61P3/10A61P3/04A61P3/06
CPCC07K14/57563C07K14/575C12N15/70A61K47/6811A61P3/10A61P3/04A61P3/06C07K2319/30C07K2319/00A61K38/00
Inventor 谭树华赵雅嫱童守芳沈家琪
Owner CHINA PHARM UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap