Recombinant L-arabinose isomerase LPAI and construction method and application thereof

A technology of arabinose and construction method, applied in the field of bioengineering, can solve problems such as high cost and low conversion efficiency, and achieve the effect of solving low conversion efficiency

Active Publication Date: 2021-07-23
JIANGSU UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the present invention, a recombinant L-arabinose isomerase LPAI is constructed by means of genetic engineering, and the

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant L-arabinose isomerase LPAI and construction method and application thereof
  • Recombinant L-arabinose isomerase LPAI and construction method and application thereof
  • Recombinant L-arabinose isomerase LPAI and construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Embodiment 1: Recombinant E. coli BL21 / pANY1- araA build

[0035] (1) Lactobacillus bruceioids published in the Genbank database ( Lactobacillus parabuchneri ) of the coded L-AI araA The gene sequence (NCBI accession number: NZ_CP029256.1) was used as a template, combined with the characteristics of the multi-cloning site and homology arm on the vector pANY1 (from Shenyang Agricultural University), and the upstream primer F was designed and synthesized by using the bioinformatics Snapgene software:

[0036] 5'- GGGGGATCCACTAGTAGGCCT ATGTTACAAGTACCTGATTA-3' and downstream primer R: 5'- CA GGAGCTCCCATGGAGGCCT CTACTTGATGTCGTCAATG-3’ (the underlined parts are Stu I restriction site, the wavy line is the upstream and downstream homology arms homologous to the pANY1 plasmid).

[0037] (2) Using the genomic DNA of Lactobacillus brucelli as a template, use CWBIO Pfx high-fidelity polymerase (from Jiangsu Kangwei Century Biotechnology Co., Ltd.) to PCR amplify the ...

Embodiment 2

[0040] Example 2: Induced expression and purification of recombinant L-arabinose isomerase LPAI

[0041] Recombinant E. coli BL21 / pANY1- araA Inoculate in LB liquid medium (yeast powder 10g / L, tryptone 20g / L, sodium chloride 20g / L), shake culture at 37°C and 200rpm until the OD is about 0.4, add IPTG (isopropyl alcohol) with a final concentration of 1mM β-D-thiogalactoside) induction, 25 ℃, 150 rpm low-speed overnight induction of LPAI, the expression of DTE-CM was detected by SDS-PAGE, and the recombinant bacteria induced without IPTG were used as the blank control, and then Will express successful LPAI utilizing Ni 2+ -NTI column purification, such as figure 2 As shown, lane 1 is the marker, lane 2 is the sample without adding inducer, lane 3 is the sample after the induction table, and lane 4 is the sample treated with Ni 2+ -The sample after NTI column purification, a single pure protein band with a size of 55kDa, the pure enzyme sample is preserved, named LPAI, and...

Embodiment 3

[0045] In order to investigate the enzymatic properties of the recombinant L-arabinose isomerase LPAI, the enzymatic activity of the recombinant L-arabinose isomerase LPAI under different metal ions and concentrations, different temperatures and pH environments were studied respectively.

[0046] (1) Effect of temperature on LPAI enzyme activity:

[0047] Set up multiple groups of experiments, add LPAI to the D-galactose substrate solution, and carry out the reaction for 1 hour at 30, 35, 40, 45, 50, 55, 60 and 65°C respectively, and measure the enzyme activity at different temperatures , to obtain the optimum temperature of the enzyme. Such as image 3 As shown, as the temperature increased, the enzyme activity became higher and higher, and when the temperature was 45°C, the enzyme activity reached the highest. Then the temperature increased again, and the enzyme activity gradually decreased.

[0048] After incubating the LPAI in the above test group for two hours, its res...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides a recombinant L-arabinose isomerase LPAI and a construction method and application thereof. The recombinant L-arabinose isomerase LPAI is constructed by utilizing a genetic engineering means; and the recombinant L-arabinose isomerase LPAI can be applied to preparation of D-tagatose by taking D-galactose as a substrate, and the problems of low conversion efficiency, high cost and the like in a D-tagatose production process are effectively solved.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and specifically relates to a recombinant L-arabinose isomerase LPAI and its construction method and application. Background technique [0002] D-tagatose, a low-calorie sweetener with the molecular formula C 6 h 12 o 6 , which has a series of physiological effects such as low calorie, anti-oxidation, anti-caries, etc., and is widely used in the production of fruit juice, lactic acid bacteria beverage, chewing gum, diet food and other food fields. And in the field of medicine, D-tagatose can also be used in the production of cough syrup, oral disinfectants, etc. However, D-tagatose is difficult to carry out large-scale industrial production. [0003] At present, the production of D-tagatose is mainly two kinds of chemical method and biological method. The chemical method is mainly to undergo isomerization reaction of D-galactose with metal hydroxide under the action of soluble alkali ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/90C12N15/61C12N15/70C12P19/24C12P19/02C12R1/19
CPCC12N9/90C12N15/70C12P19/24C12P19/02C12Y503/01004
Inventor 齐向辉袁娇张国艳员君华张宇飞王洋
Owner JIANGSU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap