Scylla paramamosain C-type lectin as well as preparation method and application thereof

A technology of Scylla lectin and lectin, which is applied in the field of Scylla lectin C-type lectin and its preparation, to achieve the effects of reducing the harm of antibiotics, small molecular weight, and poor immunogenicity

Active Publication Date: 2021-08-10
ZHEJIANG SCI-TECH UNIV
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there is no report on the use of C-type lectin of the mud crab as an animal-derived immune enhancer to prevent and control the breeding diseases of the mud crab

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Scylla paramamosain C-type lectin as well as preparation method and application thereof
  • Scylla paramamosain C-type lectin as well as preparation method and application thereof
  • Scylla paramamosain C-type lectin as well as preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] 1) Synthesize the gene (SEQ ID No. 2):

[0028] ACGGACGTCAACTCATCAAATACCGAGTGCCACAGCCCTTTCACGGAGGTTGCAGGTCGCTGCTTGCACATTGAAGTCGCCACCACTGGCTCGTGGCACAATATGCGAAAGCTCTGTCAGGACCTTGGGGGTGACCTGGTCAATCTTTCTGATCTGCAATTCTACGGTGACCTCATTTTGTACATTAAAAGTTTACATTTGCCATACGTTCATTTGTGGATCGGTGCCACGGACGAGGCGACGGAGGGCATCTGGATGTGGACAGATGGGACACCCGTCAGGATGGGCACTCCTTACTGGGCCAACTATAAGGACAACGTTCAAATGCCTGCTGGAGGAGAGAATCAAAACTGTGCTATGCTTGATATAAACATGCATTATTATTTCAATGATTATGGCTGTTCGTCACCAGATATAAGTCCGATTTGTGAG

[0029] 2) After adding an enzyme-cut position Ncol / XHOL and HIS tag, it is synthesized to a gene fragment: the whole gene synthesis of the present embodiment is enrichment. Finance Biotechnology (Shanghai) Co., Ltd. (hereinafter referred to as the business);

[0030] The gene fragment obtained by NCOL / XHOL dicase cut carrier PET32A and the above steps. Recovery purification, the bisase-cut gene fragment is connected to the carrier PET32a, to which the product is connected and converted into the E...

Embodiment 2

[0035] This embodiment provides a method of preparing a recombinant protein RSPCTL-2:

[0036] The recombinant expression vector described in Example 1 was converted to E. coli BL21 (DE3) in the heat excitation, and E. coli strain containing recombinant plasmid was selected, and an E. coli single colony containing recombinant plasmid after antibiotic screening will be selected. It was placed in the LB liquid medium, and 12 h at 37 ° C, 220 rpm was purified; and the bacteria liquid was cultured in the LB medium, 37 ° C, 220 rpm culture was cultured, and 0.01 mM IPTG was induced, and the induced conditions were 30 ° C. , 4H, 220 rpm, a recombinant protein that was prepared by supernatant expression.

[0037] After collecting induction, the SDS-PAGE was detected with a single strip of about 33 kD.

[0038] Purpose protein was purified by nickel column, and the SDS-PAGE was detected with a single strip of about 33 kD. figure 1 Indicated.

[0039] Among them, the general primer of the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a scylla paramamosain C type lectin Spctl-2. The amino acid sequence of the scylla paramamosain C type lectin Spctl-2 is SEQ ID No: 1. The invention also discloses a gene for coding the scylla paramamosain C-type lectin Spctl-2. The nucleotide sequence of the antibacterial protein Spctl-2 gene is SEQ ID No: 2; the invention further discloses a recombinant antibacterial protein rSpctl-2 based on the C-type lectin Spctl-2, The invention also discloses an application of the recombinant antibacterial protein rSpctl-2 in preparation of medicines for preventing and controlling Vibrio fluvialis infection. The invention also discloses an application of the recombinant antibacterial protein rSpctl-2 in preparation of medicines for preventing and controlling micrococcus luteus. The invention also discloses a preparation method of the recombinant antibacterial protein rSpctl-2. The recombinant protein is produced by using escherichia coli, has the advantage of secretory expression, is easy to industrially produce and provides more choices for designing the dosage form of the immunopotentiator.

Description

Technical field [0001] The present invention relates to the field of biological prevention and treatment of water products, and in particular, there is a preparation method and application thereof in the formula C-type coagulin and its preparation method thereof. Background technique [0002] Related diseases caused by bacterial infections, result in low survival rate of cyclic crab during breeding, thereby causing huge losses to the relevant breeding industry. At present, the prevention and treatment of the proposed blue crab disease mainly uses antibiotics and artificially synthetic antibacterial drugs to prevent disease caused by scale and intensive culture. Bacterial diseases are a aquatic disease that is generally happened in blue crab breeding, mainly caused by river arc and vines, so that the survival rate of the planar cyclic crab is low. Prevention and treatment of the disease is dominated by antibiotics, but long-term use also causes the drug resistance to enhancement, ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C07K14/435C12N15/12C12N15/70C12N15/66C12N15/62A61K38/17A61P31/04
CPCC07K14/43509C12N15/70A61P31/04C07K2319/21A61K38/00
Inventor夏艳婷黄萌萌董太伟曾博新郑小媛
OwnerZHEJIANG SCI-TECH UNIV