Agrobacterium transformation vector based on rhizobium type III effector NopP and application of vector

An Agrobacterium transformation and effector technology, applied in the field of Agrobacterium transformation vectors based on Rhizobium type III effector NopP, can solve problems such as low transformation efficiency, achieve high transformation rate, overcome host-specific limitations, and study the symbiotic mechanism The effect of promotion

Active Publication Date: 2021-08-10
SUN YAT SEN UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The inventor's research shows that LBA1334 carrying pISV-DsRed1 exhibits lower transformation efficiency

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Agrobacterium transformation vector based on rhizobium type III effector NopP and application of vector
  • Agrobacterium transformation vector based on rhizobium type III effector NopP and application of vector
  • Agrobacterium transformation vector based on rhizobium type III effector NopP and application of vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] The construction of embodiment 1 transformation vector

[0024] The vector pISV-DsRed1 T-DNA structure used in this experiment transformation is as follows: figure 1 As shown, the construction method of the vector adopts the standard enzyme-cut ligation method. All vectors contain the gene DsRed1 encoding red fluorescent protein in the mushroom coral Discosoma sp. as a selection marker for transgenic plants (Chen et al., 2009). First use PCR to amplify DsRed1 from pX-DR and connect it into the intermediate vector pRT104, cut it off with HindIII, put a 35S promoter on it, and then clone it into the pISV2678 vector to obtain pISV-DsRed1. Wherein, the bar gene expression cassette contained in the vector T-DNA region can use the herbicide Basta to select transgenic plants in other plant transformation experiments.

[0025] DsRed1 gene PCR reaction system:

[0026]

[0027]

[0028] Forward primer 1: GCTCTAGAACAATGGCCTCCTCCGAGAACGTC

[0029] Reverse primer 1: CCCTC...

Embodiment 2

[0043] Example 2 Transformation of Japonicus japonicus using Agrobacterium LBA1334, K599 and LBA1334 carrying pISV-DsRed1

[0044] The japonicus japonicus used in the experiment was (Regel) Larsen ecotype MG20 (Miyakojima MG20; Kawaguchi, 2000) seeds. The specific method includes the following steps.

[0045] 1. Surface disinfection and germination of seeds: Soak Japanese japonicus (Regel) Larsen ecotype MG20 (Miyakojima MG20; Kawaguchi, 2000) seeds with concentrated sulfuric acid for 10 min and then wash them with sterile water for at least 5 times. Then they were treated with 70% alcohol for 2 min and then transferred to 10-fold diluted commercial bleach (~0.35% active chlorine, Langkey, Guangzhou, China). Shake the seeds on a vortex mixer every 2 minutes for 10 minutes. Wash 5 times with sterile water, and finally resuspend the surface-sterilized seeds with sterile water and incubate overnight at 4°C. Then spread the seeds on 1.0% water agar plates (about 50 seeds per pl...

Embodiment 3

[0055] The vector pISV-DsRed1-nopP of the embodiment three nopP gene is transformed into LBA9402

[0056] Referring to the transformation method described in Example 2, the vector pISV-DsRed1-nopP containing the nopP gene was transformed into LBA9402, and finally used for hairy root transformation.

[0057] 1) Microscopic analysis was performed at 28dpi to detect red fluorescent roots. To detect the expression of effector genes, total RNA was extracted from roots showing red fluorescence. The transcription of nopP was detected by qRT-PCR, and the results were as follows Figure 5 As shown, it was confirmed that the effector genes could be co-expressed with DsRed1.

[0058] 2) Comparison of the transformation frequency between the control group treated with pISV-DsRed1 and the plants transformed with the binary vector containing the effector gene. Fifty plants were treated with each binary vector for testing. Among the plants of the LBA9402 treatment group carrying pISV-DsR...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bioengineering and genetic engineering, in particular to an agrobacterium transformation vector based on a rhizobium type III effector NopP and application of the vector. The coding gene of the NopP is operably connected with a promoter in the vector to form an expression element, and the expression element is inserted into multiple cloning sites of a T-DNA sequence. The constructed agrobacterium transformation vector can further improve the hairy root transformation efficiency of Lotus japonicus, the probability of obtaining transgenic hairy roots is increased, the expression of NopP does not affect normal nodulation symbiosis of the Lotus japonicus and rhizobium, and the effectiveness and practicability of hairy root transformation of the Lotus japonicus are greatly improved.

Description

technical field [0001] The invention relates to the technical fields of bioengineering and genetic engineering, and relates to the transformation of Agrobacterium rhizogenes, in particular to an Agrobacterium transformation vector based on Rhizobium type III effector NopP and application thereof. Background technique [0002] Lotus japonicus is a common research tool for the study of hairy root transformation and plant-microbe interactions. Its short life cycle can be applied to various genetic studies. The early-flowering line ecotype MG20 (Kawaguchi, M. (2000) Lotus japonicus ‘Miyakojima’ MG-20an early-flowering accession suitable for indoor handling. J Plant Res. 113(4):507–509.) is especially suitable for indoor experiments. The genome of japonicus japonicus has been sequenced (Li,C,Xue,D and Wang,Y,et al.(2020)A method for functional testing constitutive and ligand-induced interactions of lysin motif receptorproteins.Plant Methods.doi:10.1186 / s13007-020-0551-4.). Be...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/65C12N15/31A01H5/06A01H6/54
CPCC12N15/8205C12N15/8261C12N15/65C07K14/195
Inventor谢致平史德海林·奥斯丁·巴特瑟王琰
OwnerSUN YAT SEN UNIV