Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of recombinant hansenula polymorpha

A technology of Hansenula polymorpha and a construction method is applied in the field of construction of recombinant Hansenula polymorpha to achieve the effects of increasing accumulation and improving fatty acid production

Active Publication Date: 2021-08-17
DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the field of producing fatty acids and their derivatives using Hansenula as the base cell is still blank

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of recombinant hansenula polymorpha
  • Construction method and application of recombinant hansenula polymorpha
  • Construction method and application of recombinant hansenula polymorpha

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Construction of High Fatty Acid Yield Hansenula Strains

[0064] (1) Construction of gene editing CRISPR / Cas9 system

[0065]The starting strain, Ogataeapolymorpha NCYC 495leu1.1, was purchased from China General Microorganism Culture Collection Center (CGMCC 2.2412). In the early stage, the laboratory independently constructed the recombinant Hansenula 495-3 (genotype MATa, leu1.1, pGAP-hCAS9-AOX1t) integrating the CAS9 gene, and used this as the host strain to construct high-yield fatty acid and derivative strains. Wherein, the concrete construction method of bacterial strain 495-3 is as follows: first, with primer pGAP-Fw-EcoRI (CGCCGC gaattc TTTTTGTAGAAATGTCTTGG) and pGAP-Rv-XhoI (CCGTCGctcgagTGTGTTTTGATAGTTGTTCA) amplified the pGAP promoter derived from Pichia pastoris, and the vectors pPICZ A and pGAP were digested and ligated with EcoR I and Xho I, respectively, to obtain the recombinant vector pPICZA-pGAP. Amplify the human CAS9 gene (primer Cas9-Fw-SacII: AT...

Embodiment 2

[0072] Recombinant Hansenula fatty acid fermentation

[0073] (1) culture medium

[0074] YPD medium: 20g / L glucose, 20g / L peptone, 10g / L yeast powder;

[0075] SD medium: 20g / L glucose, 6.7g / L YNB, supplemented with essential amino acid components when necessary;

[0076] Fermentation medium (basic component medium): (NH 4 ) 2 SO 4 2.5g / L, KH 2 PO 4 14.4g / L, MgSO 4 ·7H 2 O0.5g / L, add about 900mL ddH 2 O, adjust the pH to 5.6, dilute to 950mL, and sterilize at 115°C for 30min. After sterilization, add 1mL vitamin solution and 2mL trace metal solution, and add essential amino acids when using. Add different kinds of carbon sources to the fermentation medium, including 20g / L glucose, 10g / L methanol and 20g / L xylose, etc., for fatty acid fermentation.

[0077] (2) Experimental process and conditions

[0078] For strain activation, pick 3 single colonies and place them in 3 / 15mL YPD medium or SD medium, and culture them with shaking at 220rpm at 37°C for 24h; Transf...

Embodiment 3

[0087] Effect of NADPH Supply on Fatty Acid Synthesis

[0088] The production process of fatty acids consumes NADPH extremely. When glucose is used as the substrate, although cells can rely on the pentose phosphate pathway to provide NADPH, the supply may still be insufficient. Therefore, we additionally introduced other NADPH supply pathways, including overexpressing the cytoplasmic isocitrate dehydrogenase ScIDP2 gene, and knocking out the succinyl-CoA synthetase OpLSC2 gene ( image 3 ).

[0089] (1) Overexpression of isocitrate dehydrogenase 2 (ScIDP2)

[0090] Citrate or isocitrate in the cytoplasm will form α-ketoglutarate under the catalysis of isocitrate dehydrogenase Idp2p, accompanied by the generation of NADPH ( image 3 ). Therefore, overexpression of ScIDP2 gene is a commonly used strategy to increase intracellular NADPH supply. However, there is no cytoplasmic ScIDP2 gene in Hansenula, and we first considered overexpressing the ScIDP2 gene from Saccharomyces ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method and application of a recombinant hansenula polymorpha strain. The method comprises the following steps: constructing an sgRNA expression vector of a targeted nucleotide sequence; and introducing the expression vector into a hansenula polymorpha strain, and knocking out an OpFAA1 gene in the strain. The invention also provides a construction method of the recombinant hansenula polymorpha strain used for fatty alcohol synthesis. The constructed recombinant hansenula polymorpha strain can effectively accumulate fatty acid under various carbon source conditions. On the basis, the unit yield of biomass fatty acid is further improved by increasing the supply of NADPH in cells. Meanwhile, MmCAR, npgA, ADH5 and FaCoAR are overexpressed, the gene OPFAA1 or / and the gene OpHFD1 are knocked out, so fatty alcohol synthesis is achieved in hansenula polymorpha for the first time. Furthermore, free expression of JeOleT in a high-yield fatty acid strain realizes synthesis of alpha-olefin, and the application potential of JeOleT in cell factories is expanded.

Description

technical field [0001] The invention belongs to the application field of microbial genetic engineering and metabolic engineering, and specifically relates to a construction method, optimization and application of a recombinant Hansenula polymorpha producing fatty acids, fatty alcohols and alpha-olefins. Background technique [0002] Fatty acids and their derivatives (fatty alcohols, fatty acid alkyl esters and alkanes, etc.) have wide application potential in the fields of energy, medicine and cosmetics. Biofuels and oil compounds derived from fatty acids have gradually become the main substitutes for gasoline, diesel and aviation fuels due to their higher energy density, storage and transportation characteristics and combustion performance that are more similar to existing fuels. Free fatty acids are also widely used in the production of chemical products such as soaps, surfactants and lubricants. In addition, fatty alcohols are currently the main raw materials for the pro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/19C12P7/64C12P7/02C12R1/78
CPCC12N9/0006C12N9/0008C12N9/1029C12N9/001C12N9/93C12P7/6463C12P7/6472C12P7/02C12Y203/01086C12Y103/03006C12Y101/01042C12Y602/01005C12Y102/99006C12Y102/01042
Inventor 周雍进高教琪李云霞
Owner DALIAN INST OF CHEM PHYSICS CHINESE ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com