Construction method of high-yield strain for transforming abinogen by using glucose

A technology for glucose conversion and high-yielding strains, which is applied in the field of Bacillus subtilis genetic engineering, and can solve problems such as the inability to synthesize the target product Fenggenin

Active Publication Date: 2021-08-17
TIANJIN UNIV
View PDF4 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although the chassis cell Bacillus subtilis 168 strain can use glucose for growth, it cannot synthesize the target product Fengyuan

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of high-yield strain for transforming abinogen by using glucose
  • Construction method of high-yield strain for transforming abinogen by using glucose
  • Construction method of high-yield strain for transforming abinogen by using glucose

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Construction of Fengyuansu Synthetic Strain BSP000

[0043] (1) Design and synthesis of P43 promoter amplification primers. According to the nucleotide sequence of the P43 promoter, its nucleotide sequence is shown in SEQ ID NO: 1, and the amplification primers were designed as follows (the underlined line indicates the restriction site), and the primers were synthesized by Qingke Biotechnology Co., Ltd.

[0044] P43-F1:CCC AAGCTT GCGGCTTCCTTGTAGAGCTCAGC(HindⅢ)

[0045] P43-R1:

[0046] CGC GGATCC CTCGAGACGCGTGCATGCTCTAGAAGATCTCTGCAGGTCGACCATGTGTACATTCCTCTC(BamHI)

[0047] (2) Extraction of Bacillus subtilis 168 genome. Collect 3-5mL of overnight cultured Bacillus subtilis bacteria solution in a centrifuge tube, centrifuge at 12000rpm for 1min, discard the supernatant, and collect the bacterial precipitate. Add 1 mL of sterile water to the centrifuge tube to suspend the precipitate, centrifuge at 12,000 rpm for 1 min, discard the supernatant, and repe...

Embodiment 2

[0060] Example 2: Construction of Fengyuansu high-yielding strain BSP003

[0061] (1) For the BSP000 strain, collect all the gene-protein-reaction information of the strain from the database, and after optimization such as filling in missing reactions and removing redundant reactions, construct a genome-scale network metabolic model of the BSP000 strain, and then use the flux balance Three overexpression targets of accA, cypC and gapA were simulated by analysis (FBA) and minimal metabolic modulation (MOMA) algorithms.

[0062] (2) Design and synthesis of P43 promoter, accA, cypC and gapA gene amplification primers. Respectively according to accA gene (its nucleotide sequence is shown in SEQ ID NO:5), cypC gene (its nucleotide sequence is shown in SEQ ID NO:6) and gapA gene (its nucleotide sequence is shown in SEQ ID NO : 7) nucleic acid sequence, the amplification primers are designed as follows (the underlined line indicates the restriction site), and the primers are synthes...

Embodiment 3

[0074] Embodiment three: the cultivation and fermentation of BSP000 and BSP003 bacterial strains

[0075] (1) Culture medium composition:

[0076] Seed medium: tryptone 10g / L, yeast extract powder 5g / L, NaCl 10g / L, pH 7.0;

[0077] Fermentation medium: glucose 20g / L, peptone 20g / L, MgSO 4 ·7H 2 O 0.5g / L, Na 2 HPO 4 2H 2 O0.4g / L, NaH 2 PO 4 0.154g / L, pH 7.2-7.4.

[0078] (2) Cultivation and fermentation of BSP000 and BSP003 strains. The fengyuansu synthetic strain BSP000 and the fengyuansu high-yielding strain BSP003 of the present invention were respectively connected to LB liquid medium at 37°C for activation and culture for 12-14 hours, and the bacterial liquid was taken to continue to be cultured on a solid plate, and cultured upside down at 37°C for 16 hours , take the colony with larger diameter, carry out seed culture in 50mL seed culture medium with liquid filling capacity, cultivate at 37°C and 220rpm / min for 12h, obtain seed liquid, and inoculate it into the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a construction method of a high-yield strain for transforming abinogen by using glucose, which comprises the following steps: connecting a P43 promoter gene and a degQ gene from bacillus subtilis 168 and an sfp gene from bacillus amyloliquefaciens FZB42 in series to form a gene expression module pHP13-P43-sfp-degQ, and transferring the module into an original strain of the bacillus subtilis 168 to obtain a strain cell BSP000 for synthesizing abinogen. Three overexpression target genes accA, cypC and gapA are predicted by constructing a BSP000 strain genome scale metabolic network model, and the three genes are overexpressed in the BSP000 strain to obtain an engineering strain BSP003 with high yield of the abinogen, and the fermentation yield of the abinogen reaches 59.87 mg / L and is increased by 126% compared with that of an artificial strain BSP000. The method has a practical application value for realizing industrial production of the abundant essence.

Description

technical field [0001] The invention belongs to the technical field of Bacillus subtilis genetic engineering, and specifically relates to a method for constructing a genetically engineered bacterial strain capable of utilizing glucose to synthesize fengogenin by serially co-expressing the sfp gene degQ gene, and using a model to simulate a target gene for overexpression, Finally, the increase of Fengyuan element production of the engineering strain was realized. Background technique [0002] Lignocellulose is an abundant renewable resource on the earth. After hydrolysis, it can produce five-carbon sugars such as arabinose and xylose, and six-carbon sugars such as glucose and galactose. The comprehensive treatment and utilization of lignocellulose by biological methods will be beneficial to the solution of environmental problems. [0003] At present, there are strains that use glucose to convert fengyuan in nature, such as Bacillus amyloliquefaciens LPB-18N (CN201911402559.6...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/75C12N15/54C12N15/52C12N15/31C12P21/02C12R1/125
CPCC12N15/75C12N15/52C12N9/1288C12N9/93C07K14/32C12P21/02C07K7/06C12Y604/01002
Inventor闻建平何明亮银莹
OwnerTIANJIN UNIV