Mutated Aspergillus oryzae strain
A technology of Aspergillus oryzae and strain, applied in the field of microorganisms, can solve problems such as low expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] Embodiment 1: Obtaining of orotidine-5' phosphate decarboxylase auxotrophic Aspergillus oryzae strain
[0034] With reference to patent CN201310288060.3, the spores of Aspergillus oryzae CICC2012 were inoculated and coated on MM solid medium (1% glucose, 0.15% KH) added with 0.04% inositol 2 PO 4 , 0.6% NaNO 3 , 0.05% KCl, 0.05% MgSO 4 , 2% agar powder), 28 ℃, static culture for 5 days, to obtain enriched monokaryotic Aspergillus oryzae spores. Fresh spores of Aspergillus oryzae CICC2012 were eluted with spore washing solution (0.9% NaCl, 0.05% Tween 80), filtered through Miracloth (Calbiochem, Cat# 475885) to prepare a spore suspension, and the cells were washed twice with sterile water and dried. Adjust to 1×10 7 individual / mL. Take 2 mL of spore suspension and evenly disperse it on the surface of the petri dish, place it under the ultra-clean workbench and irradiate it with ultraviolet light for 90 s, take 100 μL and apply it to the culture dish supplemented wi...
Embodiment 2
[0035] Embodiment 2: Construction of RML expression vector
[0036] Exogenous Rhizomucor miehei ( Rhizomucor miehei ) lipase (RML) gene sequence is as follows.
[0037] Nucleic acid sequence:
[0038] gtgccaatcaagagacaatcaaacagcacggtggatagtctgccacccctcatcccctctcgaacctcggcaccttcatcatcaccaagcacaaccgaccctgaagctccagccatgagtcgcaatggaccgctgccctcggatgtagagactaaatatggcatggctttgaatgctacttcctatccggattctgtggtccaagcaatgagcattgatggtggtatccgcgctgcgacctcgcaagaaatcaatgaattgacttattacactacactatctgccaactcgtactgccgcactgtcattcctggagctacctgggactgtatccactgtgatgcaacggaggatctcaagattatcaagacttggagcacgctcatctatgatacaaatgcaatggttgcacgtggtgacagcgaaaaaactatctatatcgttttccgaggttcgagctctatccgcaactggattgctgatctcacctttgtgccagtttcatatcctccggtcagtggtacaaaagtacacaagggattcctggacagttacggggaagttcaaaacgagcttgttgctactgttcttgatcaattcaagcaatatccaagctacaaggttgctgttacaggtcactcactcggtggtgctactgcgttgctttgcgccctgggtctctatcaacgagaagaaggactctcatccagcaacttgttcctttacactcaaggtcaaccacgggtaggcgaccctgcctttgccaactacgttgttagcaccggcatt...
Embodiment 3
[0043] Embodiment 3: Aspergillus oryzae PyrG L4 replenishment experiment
[0044] Fresh Aspergillus oryzae PyrG L4 spores were eluted with spore washing solution (0.9% NaCl, 0.05% Tween 80), filtered through Miracloth to prepare a spore suspension, and adjusted to 1 × 10 7 individual / mL. Inoculate 1mL of spore suspension into mycelia medium (2% tryptone, 1% yeast extract, 2% glucose, 0.3% uracil), culture at 28°C, 180rpm for 40 hours, and collect by sterilizing Miracloth filter growing hyphae.
[0045] The collected hyphae were sterilized with osmotic pressure stabilizer (0.6 M MgSO 4 , 10mM NaH 2 PO 4 , pH=5.8) washed three times and pressed dry. Mycelium was transferred to a 100mL Erlenmeyer flask. Resuspend every 0.8g mycelium in 20mL enzymolysis solution (use osmotic pressure stabilizer to prepare 1% lyase, 1% cellulase, 0.1% helicase enzymolysis solution, filter through 0.22 μm microporous membrane Bacteria), at 30°C, 90 rpm, for 60-90min. The enzymatically hydro...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


