Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof
An RT-PCR and retrovirus technology, applied in the field of fox retrovirus SYBRGreen I fluorescent RT-PCR kit, can solve the problem of no fox retrovirus SYBRGreen I fluorescent RT-PCR detection kit, etc., and achieve good application prospects, Good specificity and low operator requirements
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The establishment of embodiment 1 fox retrovirus SYBR Green Ⅰ fluorescent RT-PCR detection method
[0035] 1. Primer design and synthesis
[0036] According to the POL gene sequence of fox retrovirus measured in the previous research of our laboratory, after sequence comparison, the conserved region was selected to design amplification primers. There were 3 pairs of primers, and the sequences were as follows:
[0037] First pair of primers:
[0038] SEQ ID No.1: Upstream primer ACCTGGGACTACGACACTG,
[0039] SEQ ID No.2: downstream primer CCTGCTGGCGTCTCATCT;
[0040] Second pair of primers:
[0041]SEQ ID No.5: Upstream primer CGGGTGGTCCCGACCTG,
[0042] SEQ ID No.6: downstream primer GTTCCATCTTTCCCCTGC;
[0043] The third pair of primers:
[0044] SEQ ID No.7: Upstream primer CAAAGGTACGTGCTATAGTG,
[0045] SEQ ID No.8: downstream primer CTCTAACTTATTACAAATAC;
[0046] The above primer sets were synthesized by General Biosystems (Anhui) Co., Ltd.
[0047] 2. Prep...
Embodiment 2
[0071] Embodiment 2 kit sensitivity analysis
[0072] The test kit provided in Example 1 was used for testing.
[0073] (1) Prepare the pMD-POL standard solution, calculate the copy number according to the concentration of the pMD-POL plasmid standard product respectively, and the pMD-POL plasmid copy number is 3.2×10 10 copy / μL;
[0074] Dilute the plasmid standard in a 10-fold ratio serial gradient, and take 10 6 Copy / μL~10 -1 Copy / μL pMD-POL plasmid standard product is used as the plasmid standard product template, and the obtained template solutions are numbered respectively, as follows:
[0075] Standard template 1: 3.2×10 6 pMD-POL plasmid standard in copies / μL;
[0076] Standard template 2: 3.2×10 5 pMD-POL plasmid standard in copies / μL;
[0077] Standard template 3: 3.2×10 4 pMD-POL plasmid standard in copies / μL;
[0078] Standard template 4: 3.2×10 3 pMD-POL plasmid standard in copies / μL;
[0079] Standard product template 5: 3.2×10 2 pMD-POL plasmid stand...
Embodiment 3
[0088] Embodiment 3 kit specificity analysis
[0089](1) Prepare the template: use plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, Escherichia coli, Pasteurella, and Staphylococcus genome as templates, and nuclease-free water as a control, and set aside;
[0090] (2) Fluorescent RT-PCR amplification: The total system of fluorescent RT-PCR is 20 μL: 10 μL of 2×Onestep TB Green RT-PCRBufferⅢ, 1 μL of enzyme mixture, 2 μL of primer set, 6 μL of nuclease-free water, add to 0.1 mL amplification tube , prepare 8 parts, stand-by; marked as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8# for use;
[0091] Add the plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, E. In #, 6#, and 7#, add nuclease-free water to 8#, after adding the sample, centrifuge briefly, and put it in a fluorescent PCR instrument for amplification reaction;
[0092] Fluorescent RT-PCR amplification conditions were: reverse transcription at 42°C for 5 min; pre...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap