Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof

An RT-PCR and retrovirus technology, applied in the field of fox retrovirus SYBRGreen I fluorescent RT-PCR kit, can solve the problem of no fox retrovirus SYBRGreen I fluorescent RT-PCR detection kit, etc., and achieve good application prospects, Good specificity and low operator requirements

Active Publication Date: 2021-09-28
SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, there is no detection method for any fox retrovirus at home and abroad, and there is no fox retrovirus SYBRGreen I fluorescent RT-PCR detection kit. Therefore, the research of the present invention has great significance for the detection of fox retrovirus

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof
  • Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof
  • Fox retrovirus SYBR Green I fluorescent RT-PCR kit and use method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The establishment of embodiment 1 fox retrovirus SYBR Green Ⅰ fluorescent RT-PCR detection method

[0035] 1. Primer design and synthesis

[0036] According to the POL gene sequence of fox retrovirus measured in the previous research of our laboratory, after sequence comparison, the conserved region was selected to design amplification primers. There were 3 pairs of primers, and the sequences were as follows:

[0037] First pair of primers:

[0038] SEQ ID No.1: Upstream primer ACCTGGGACTACGACACTG,

[0039] SEQ ID No.2: downstream primer CCTGCTGGCGTCTCATCT;

[0040] Second pair of primers:

[0041]SEQ ID No.5: Upstream primer CGGGTGGTCCCGACCTG,

[0042] SEQ ID No.6: downstream primer GTTCCATCTTTCCCCTGC;

[0043] The third pair of primers:

[0044] SEQ ID No.7: Upstream primer CAAAGGTACGTGCTATAGTG,

[0045] SEQ ID No.8: downstream primer CTCTAACTTATTACAAATAC;

[0046] The above primer sets were synthesized by General Biosystems (Anhui) Co., Ltd.

[0047] 2. Prep...

Embodiment 2

[0071] Embodiment 2 kit sensitivity analysis

[0072] The test kit provided in Example 1 was used for testing.

[0073] (1) Prepare the pMD-POL standard solution, calculate the copy number according to the concentration of the pMD-POL plasmid standard product respectively, and the pMD-POL plasmid copy number is 3.2×10 10 copy / μL;

[0074] Dilute the plasmid standard in a 10-fold ratio serial gradient, and take 10 6 Copy / μL~10 -1 Copy / μL pMD-POL plasmid standard product is used as the plasmid standard product template, and the obtained template solutions are numbered respectively, as follows:

[0075] Standard template 1: 3.2×10 6 pMD-POL plasmid standard in copies / μL;

[0076] Standard template 2: 3.2×10 5 pMD-POL plasmid standard in copies / μL;

[0077] Standard template 3: 3.2×10 4 pMD-POL plasmid standard in copies / μL;

[0078] Standard template 4: 3.2×10 3 pMD-POL plasmid standard in copies / μL;

[0079] Standard product template 5: 3.2×10 2 pMD-POL plasmid stand...

Embodiment 3

[0088] Embodiment 3 kit specificity analysis

[0089](1) Prepare the template: use plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, Escherichia coli, Pasteurella, and Staphylococcus genome as templates, and nuclease-free water as a control, and set aside;

[0090] (2) Fluorescent RT-PCR amplification: The total system of fluorescent RT-PCR is 20 μL: 10 μL of 2×Onestep TB Green RT-PCRBufferⅢ, 1 μL of enzyme mixture, 2 μL of primer set, 6 μL of nuclease-free water, add to 0.1 mL amplification tube , prepare 8 parts, stand-by; marked as 1#, 2#, 3#, 4#, 5#, 6#, 7#, 8# for use;

[0091] Add the plasmid pMD-POL, canine distemper virus, fox parvovirus, infectious hepatitis virus, E. In #, 6#, and 7#, add nuclease-free water to 8#, after adding the sample, centrifuge briefly, and put it in a fluorescent PCR instrument for amplification reaction;

[0092] Fluorescent RT-PCR amplification conditions were: reverse transcription at 42°C for 5 min; pre...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a fox retrovirus SYBR Green I fluorescent RT-PCR kit and a use method. The kit comprises a nucleic acid releasing agent, 2 * One step TB Green RT-PCR Buffer III, an enzyme mixed solution, a negative control, a positive control and a primer group; the nucleotide sequence of the primer group is a specific base sequence as shown in SEQ ID No. 1 and SEQ ID No. 2; and the use method comprises the following steps: preparing a to-be-detected sample template, performing fluorescent RT-PCR amplification and analyzing a result. The detection primer is used in the SYBR Green I fluorescent RT-PCR kit, so that the kit has the advantages of wide applicability and strong applicability, and also has the advantages of high detection accuracy and strong specificity; and in addition, by using the kit, fox retrovirus detection can be completed through one-time sample adding, the detection process is simple, and operation is easy.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a fox retrovirus SYBR Green I fluorescent RT-PCR kit and a use method. Background technique [0002] Fox retroviruses can cause serious diseases in foxes. The clinical manifestations are slow growth, increased feed-to-meat ratio, severe immunosuppression, and decreased resistance in foxes, which are prone to secondary diseases and lead to high mortality. This disease is a new disease that seriously affects the economic benefits of the fox breeding industry in recent years, and has caused serious economic losses to the fox breeding industry. [0003] Early and rapid detection of the virus is the key to the prevention and control of the disease. However, in the current literature, there are very few records and reports about the retrovirus. Virus isolation and culture operations are cumbersome and difficult to isolate successfully. In order to monitor the clinical o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/686C12Q1/6806C12R1/93
CPCC12Q1/702C12Q1/686C12Q1/6806C12Q2563/107C12Q2545/113C12Q2523/32C12Q2527/125
Inventor 王玉茂于新友韩强付石军郭广君庄金秋王建军沈志强
Owner SHANDONG BINZHOU ANIMAL SCI & VETERINARY MEDICINE ACADEMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com