Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Trichoderma viride engineering bacterium capable of synthesizing melatonine as well as construction method and application of trichoderma viride engineering bacterium

A technology of Trichoderma viride and engineering bacteria, applied in the field of agricultural microorganisms, can solve problems such as undetected melatonin, and achieve the effects of effective plant growth-promoting ability, low cost and simple operation method

Active Publication Date: 2022-01-14
BIOLOGY INST OF SHANDONG ACAD OF SCI
View PDF5 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no report on the synthesis of melatonin by Trichoderma, and no melatonin has been detected in its bacteria and fermentation broth.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Trichoderma viride engineering bacterium capable of synthesizing melatonine as well as construction method and application of trichoderma viride engineering bacterium
  • Trichoderma viride engineering bacterium capable of synthesizing melatonine as well as construction method and application of trichoderma viride engineering bacterium
  • Trichoderma viride engineering bacterium capable of synthesizing melatonine as well as construction method and application of trichoderma viride engineering bacterium

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Embodiment 1: the cloning of hANNAT and hAMST gene sequence and the construction of expression vector

[0059] (1) Cloning of hANNAT and hAMST gene expression cassettes

[0060] The codon-optimized hANNAT and hAMST gene sequences were obtained by chemical synthesis. Using the codon-optimized hANNAT gene sequence as a template, using the sequence shown in SEQ ID NO.3 (hANNAT-YH-SpeI-Forward: CGGACTAGTATGAGCACCCAGTCCACGCA) and SEQ ID NO.4 (hANNAT-YH-BstEII-Reverse: GGGTTACCTCAACCCCCGAGTTGCGTCG) Primer sequence, cloning obtains the hANNAT gene expression cassette with enzyme-cut junction site (SpeI and BstEII); With the hAMST gene sequence after codon optimization as template, utilize such as SEQ ID NO.5 (hAMST-YH-SpeI-Forward: CGGACTAGTATGGGCTCATCTGAAGACCA) and the primer sequence shown in SEQ ID NO.6 (hAMST-YH-BstEII-Reverse: GGGTTACCTCATTTTCTCGCCAGTATGCCGT), the hAMST gene expression cassette with enzyme-cleaved junction sites (SpeI and BstEII) was obtained by cloning. ...

Embodiment 2

[0068] Example 2: Protoplast preparation and construction of overexpression engineering strains

[0069] (1) Protoplast preparation

[0070] Trichoderma viride Tv-1511 was inoculated on a PDA plate, and after culturing at 28°C for 10 days, a large amount of fresh conidia were produced; with 10mL of normal saline (0.9% NaCl, 0.05% Tween-20), the mycelial surface was washed, filtered through glass wool paper, Removing the mycelia to obtain a spore suspension;

[0071] Spread 200 μL of the spore suspension on a cellophane-covered PDA plate, and incubate at 28°C in the dark for 24 hours to germinate the spores on the PDA plate;

[0072] Preparation of lysing enzyme solution: Take 0.15 g of lysing enzyme (Lysing enzyme, Sigma: L1412) and dissolve it in 20 mL of solution I (1.2M D-sorbitol, 0.1M KH 2 PO 4 ,pH 5.6), 0.2μM membrane filter sterilization;

[0073] Take out the PDA plate, take out the fiber membrane with hyphae and stick it on the plate containing 3-4mL lysate, and t...

Embodiment 3

[0085] Embodiment 3: the detection of melatonin content in Trichoderma viride starting strain and engineering strain Tv-1511-hANNAT / hAMST fermented liquid

[0086] Inoculate 200 μL of spores of Trichoderma origin strain (Wildtype) and engineered strain (Tv-1511-hANNAT / hAMST) into PDB liquid medium, culture at 28°C and 180 rpm for 96 hours, and take samples every 24 hours. After the mycelium was filtered through two layers of sterile gauze, the liquid fermentation broth was recovered, and the recovered fermentation broth was centrifuged at 10,000 rpm to obtain the supernatant, which was filtered through a 0.45 μm filter membrane for use. Quantitative and qualitative detection of melatonin by high performance liquid chromatography. The content of melatonin in the fermentation broth was detected.

[0087] The results showed that no melatonin content could be detected in the fermentation broth of the starting strain (Wildtype), but in the Tv-1511-hANNAT / hAMST engineering strain, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of agricultural microorganisms and biology, and relates to a trichoderma viride engineering bacterium capable of synthesizing melatonine as well as a construction method and application of the trichoderma viride engineering bacterium. In order to solve the problem that synthesis of the melatonin is not found in a trichoderma strain at present, the invention constructs a trichoderma viride engineering bacterium with melatonin synthesis ability, the engineering bacterium heterologously expresses an aralkylamine-N-acetyltransferase (AANAT) coding gene hAANAT and an acetyl serotonin-O-methyltransferase (ASMT) coding gene hASMT which are derived from a human genome, and the starting strain is trichoderma viride Tv-1511. The genetically engineering bacterium constructed by the invention has the capability of synthesizing the melatonin, and the melatonin yield can be detected to reach 21.26 mg / L in fermentation liquor of the genetically engineering bacterium. Besides, the genetically engineering bacterium has better growth and sporulation characteristics, stronger adversity stress tolerance, higher pathogen antagonism and more effective plant growth promoting capability. The engineering bacterium can promote the application of the Trichodermaviride to agricultural and industrial production.

Description

technical field [0001] The invention belongs to the field of agricultural microorganisms and the field of biotechnology. The invention relates to a Trichoderma viride engineering bacterium capable of synthesizing melatonin, its construction method and application. Background technique [0002] The information disclosed in this background section is only intended to increase the understanding of the general background of the present invention, and is not necessarily taken as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to those skilled in the art. [0003] Melatonine, scientific name N-acetyl-5-methoxytryptamine, also known as pineal gland, is a small molecule biological amine widely present in animals and plants, and has important physiological functions. The content of melatonin in human and animals is very small, only pg / mL level, but its physiological functions are very important. The main functions include regu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/15C12N15/54C12N15/80C12N15/66C12P17/10C12R1/885
CPCC12N9/1029C12N9/1007C12N15/80C12N15/66C12P17/10C12Y203/01087C12Y201/01004C12N2800/22Y02A40/10
Inventor 李哲张豪霍雪雪郭凯黄艳华
Owner BIOLOGY INST OF SHANDONG ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com