Method for reducing protein content of rice and improving cooking taste quality by using CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/associated protein 9) technology
A technology of protein and gluten, applied in the field of plant genetic engineering, can solve problems such as complex genetic control system, susceptibility to environmental factors, lack of genetic resources and methods, and achieve the effect of accelerating the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] (1) Selection of gRNA target
[0057] According to the gene sequence alignment of OsGluA1, OsGluA2, OsGluA3, OsGluB2, OsGluB6, OsGluB7, OsGluC and OsGluD, sequence segments with high similarity were found.
[0058] The first nucleotide of the OsGluA1 gene sequence,
[0059] According to the principle of CRISPR / Cas9 technology target site design, 4 target sequences sgRNA1, sgRNA2, sgRNA3 and sgRNA4 were selected in the sequence region with high similarity to target the above 8 genes. Different editing types are produced by site-directed cleavage and random repair of CRISPR / Cas9 protein.
[0060] The sequences of sgRNA1, sgRNA2, sgRNA3 and sgRNA4 are shown below (bases in bold are PAM sites).
[0061]
[0062] Among them, sgRNA1 targets the 511th to 533rd nucleotides of the OsGluA1 gene sequence, the 511th to 533rd nucleotides of the OsGluA2 gene sequence and the 508th to 530th nucleotides of the OsGluA3 gene sequence;
[0063] sgRNA2 targets the 874th to 896th nucl...
Embodiment 2
[0107] All the T0 generation seeds obtained from 10 transgene-positive individual plants were planted to form 243 T1 generation plants. DNA was extracted, and a total of 33 individual plants without cas9 tags were screened with primers. The primer sequences are as follows.
[0108] Cas9-F ACCAGACACGAGACGACTAA
[0109] Cas9-R ATCGGTGCGGGCCTCTTC
[0110] For the sequencing analysis of the target gene, single plants with homozygous mutations in the editing sites were selected, and a total of 7 different gene mutation combinations were screened out and named I to VI. The schematic diagram of the mutation combinations is as follows: Figure 10 shown.
[0111] I is the knockout of OsGluA1 and OsGluC, the OsGluA1 gene of I is a mutant gene obtained by deleting the 528th base of the wild-type gene, and the OsGluC gene of I is a mutant gene obtained by deleting the 356th to 357th base of the wild-type gene;
[0112] II is the knockout of OsGluA1, OsGluA2 and OsGluB2, the OsGluA1 gene...
Embodiment 3
[0119] In order to study whether multiple gene mutations can regulate the protein content of rice, the total protein in the grains of wild type and 7 kinds of mutants was extracted and analyzed by SDS-PAGE. The specific method steps are as follows.
[0120] Component protein extraction
[0121] After the seeds are mature, place them at room temperature for 3 months to balance the moisture. After husking, grinding, and sieving, place the rice flour in an oven at 42°C for about 2 days and then accurately weigh 1g (accurate to 0.01g) with a thousandth balance.
[0122] (1) Albumin: put the rice flour to be tested into a 10ml centrifuge tube, add 3ml H 2 O, shake vigorously for 2h, centrifuge at 10000g for 20min, and take the supernatant;
[0123](2) Globulin: Add 3ml 0.5M NaCl solution to the above precipitate, shake for 2h, centrifuge at 10000g for 20min, and take the supernatant;
[0124] (3) Glamin: Add 3ml of 70% ethanol to the above precipitate, seal the centrifuge tube wi...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More