Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector of switchgrass SBP-box transcription factor PvSPL6

A technology of recombinant vectors and transcription factors, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of energy crop plant type improvement, yield increase molecular design, insufficient gene resource pool, etc., and achieve the length of stem nodes. Effects of shortening, delaying flowering time, increasing node length and biomass

Active Publication Date: 2022-03-25
QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The technical problem to be solved by the present invention is to provide an application of inhibiting switchgrass SBP-box transcription factor PvSPL6 in delaying switchgrass flowering and increasing plant biomass production, so as to solve the shortage of gene resource banks for energy plant biomass improvement at the same time Improvement of Energy Crops Plant Type and Demand for Molecular Design to Increase Yield

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector of switchgrass SBP-box transcription factor PvSPL6
  • Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector of switchgrass SBP-box transcription factor PvSPL6
  • Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector of switchgrass SBP-box transcription factor PvSPL6

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Embodiment 1: the amplification of PvSPL6 and PvSPL6-RNAi sequence

[0027] According to the switchgrass genome information published on the Phytozome (https: / / phytozome.jgi.doe.gov) website, primers (PvSPL6-F and PvSPL6-R) were designed on both sides of the full-length PvSPL6 sequence, and the non-conserved PvSPL6 gene Segment Design Primers (PvSPL6-RNAi-F and PvSPL6-RNAi-R) The cDNA of switchgrass was used as a template, and the above primers were used for PCR amplification.

[0028] The primer sequences are as follows:

[0029] PvSPL6-F: atgagagctaagcaagctagc

[0030] PvSPL6-R: ttatctgatctggaagtggttccgt

[0031]PvSPL6-RNAi-F: cccttgcttcgtgtcatcgt

[0032] PvSPL6-RNAi-R: tgccgtagcagggttctgtc

[0033] The PCR reaction system is: 2 μL cDNA, 25 μL 2×Buffer, 4 μL 10pM dNTP, 2 μL each of 10 μM forward and reverse primers, 0.5 μL 5U / μL PrimerSTAR HS DNA polymerase and 14.5 μL ddH 2 O. Mix well after adding the sample on ice. The PCR reaction conditions were: 98°C for...

Embodiment 2

[0041] Example 2: Construction of recombinant vector and transient expression in tobacco cells to observe subcellular localization

[0042] Using the above-mentioned full-length sequence fragment as a template, design PvSPL6 with a linker primer seamlessly connected to the expression vector pCABIA1300-cGFP, and amplify the fragment with a high-fidelity enzyme; use the restriction endonuclease HindIII to digest the expression vector pCABIA1300- cGFP. The PvSPL6 gene fragment and the pCABIA1300-cGFP vector fragment were recovered. The two recovered fragments were ligated by homologous recombination using seamless ligase (purchased from Vazyme). The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method. Single-clonal colonies were picked, amplified and cultured in liquid LB medium containing kanamycin, and subjected to PCR amplification detection and sequencing verification to obtain recombinant plasmid pCABIA1300-PvSPL6-cGFP.

[0043...

Embodiment 3

[0044] Example 3: Obtaining of PvSPL6 Transgenic Switchgrass Plants

[0045] The overexpression and interference expression vectors were respectively designed to connect the entry vector primers: PvSPL6-pGWC-F and PvSPL6-pGWC-R, PvSPL6-RNAi-pGWC-F and PvSPL6-RNAi-pGWC-R, and the end of the primers was introduced into the AhdI restriction site 18 bases (seamless linker sequence) behind the entry vector pGWC restriction site, using the obtained full-length sequence of PvSPL6 as a template, PCR amplification was performed with the above primers.

[0046] The primer sequences are as follows:

[0047] PvSPL6-pGWC-F: aaagcaggctttgacttt atgagagctaagcaagctagc

[0048] PvSPL6-pGWC-R: gctgggtctagagactt ttatctgatctggaagtggttccgt;

[0049] PvSPL6-RNAi-pGWC-F: aaagcaggctttgacttt cccttgcttcgtgtcatcgt

[0050] PvSPL6-RNAi-pGWC-R: gctgggtctagagactt tgccgtagcagggttctgtc;

[0051] Wherein, the underline is the sequence of the seamless junction linker.

[0052] The above-mentioned a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to application of a switchgrass SBP-box type transcription factor PvSPL6 and a recombinant vector of the switchgrass SBP-box type transcription factor PvSPL6, and belongs to the technical field of plant genetic engineering, and the switchgrass SBP-box type transcription factor PvSPL6 can regulate and control the flowering time, the stem node length and the biomass yield of switchgrass. The invention also provides a recombinant vector which is used for overexpression of pANIC6B-PvSPL6 or inhibition expression of pANIC8B-PvSPL6-RNAi, and after the recombinant vector pANIC6B-PvSPL6 and the pANIC8B-PvSPL6-RNAi are transferred into switchgrass, the blooming time, the stem node length and the biomass yield of the switchgrass are all influenced. Compared with a wild type, the flowering time of the obtained transgenic plant (PvSPL6-RNAi) with PvSPL6 transcript inhibition expression is delayed by about 40 days, the stem node length is increased by about 50%, and the biomass is increased by 63%.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and discloses an application of SBP-box transcription factor PvSPL6, which has unknown functions in plants, in delaying switchgrass flowering time, increasing stem node length and increasing biomass production. Background technique [0002] Switchgrass (Panicum virgatum L.), a perennial C4 tall herbaceous plant, is mainly used as energy grass and pasture. As an important class of fiber biomass resources, increasing its biomass and fermentable sugar production to improve the development and utilization of switchgrass biomass has important practical application value. The completion of whole-genome sequencing of switchgrass, the publication of the expression chip database, and the improvement of the transformation system have provided resource guarantees for the mining and verification of functional genes. [0003] Flowering time is an important trait in determining the biomass o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/29C12N15/84A01H5/00A01H6/46
CPCC07K14/415C12N15/827C12N15/8261C12N15/8218Y02A40/146
Inventor 付春祥王亚梅刘文文杨瑞娟白史且姜珊珊
Owner QINGDAO INST OF BIOENERGY & BIOPROCESS TECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap