Application of switchgrass SBP-box transcription factor PvSPL6 and recombinant vector of switchgrass SBP-box transcription factor PvSPL6
A technology of recombinant vectors and transcription factors, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of energy crop plant type improvement, yield increase molecular design, insufficient gene resource pool, etc., and achieve the length of stem nodes. Effects of shortening, delaying flowering time, increasing node length and biomass
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Embodiment 1: the amplification of PvSPL6 and PvSPL6-RNAi sequence
[0027] According to the switchgrass genome information published on the Phytozome (https: / / phytozome.jgi.doe.gov) website, primers (PvSPL6-F and PvSPL6-R) were designed on both sides of the full-length PvSPL6 sequence, and the non-conserved PvSPL6 gene Segment Design Primers (PvSPL6-RNAi-F and PvSPL6-RNAi-R) The cDNA of switchgrass was used as a template, and the above primers were used for PCR amplification.
[0028] The primer sequences are as follows:
[0029] PvSPL6-F: atgagagctaagcaagctagc
[0030] PvSPL6-R: ttatctgatctggaagtggttccgt
[0031]PvSPL6-RNAi-F: cccttgcttcgtgtcatcgt
[0032] PvSPL6-RNAi-R: tgccgtagcagggttctgtc
[0033] The PCR reaction system is: 2 μL cDNA, 25 μL 2×Buffer, 4 μL 10pM dNTP, 2 μL each of 10 μM forward and reverse primers, 0.5 μL 5U / μL PrimerSTAR HS DNA polymerase and 14.5 μL ddH 2 O. Mix well after adding the sample on ice. The PCR reaction conditions were: 98°C for...
Embodiment 2
[0041] Example 2: Construction of recombinant vector and transient expression in tobacco cells to observe subcellular localization
[0042] Using the above-mentioned full-length sequence fragment as a template, design PvSPL6 with a linker primer seamlessly connected to the expression vector pCABIA1300-cGFP, and amplify the fragment with a high-fidelity enzyme; use the restriction endonuclease HindIII to digest the expression vector pCABIA1300- cGFP. The PvSPL6 gene fragment and the pCABIA1300-cGFP vector fragment were recovered. The two recovered fragments were ligated by homologous recombination using seamless ligase (purchased from Vazyme). The ligation product was transformed into Escherichia coli DH5α competent cells by heat shock method. Single-clonal colonies were picked, amplified and cultured in liquid LB medium containing kanamycin, and subjected to PCR amplification detection and sequencing verification to obtain recombinant plasmid pCABIA1300-PvSPL6-cGFP.
[0043...
Embodiment 3
[0044] Example 3: Obtaining of PvSPL6 Transgenic Switchgrass Plants
[0045] The overexpression and interference expression vectors were respectively designed to connect the entry vector primers: PvSPL6-pGWC-F and PvSPL6-pGWC-R, PvSPL6-RNAi-pGWC-F and PvSPL6-RNAi-pGWC-R, and the end of the primers was introduced into the AhdI restriction site 18 bases (seamless linker sequence) behind the entry vector pGWC restriction site, using the obtained full-length sequence of PvSPL6 as a template, PCR amplification was performed with the above primers.
[0046] The primer sequences are as follows:
[0047] PvSPL6-pGWC-F: aaagcaggctttgacttt atgagagctaagcaagctagc
[0048] PvSPL6-pGWC-R: gctgggtctagagactt ttatctgatctggaagtggttccgt;
[0049] PvSPL6-RNAi-pGWC-F: aaagcaggctttgacttt cccttgcttcgtgtcatcgt
[0050] PvSPL6-RNAi-pGWC-R: gctgggtctagagactt tgccgtagcagggttctgtc;
[0051] Wherein, the underline is the sequence of the seamless junction linker.
[0052] The above-mentioned a...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


