Recombinant C-reactive proteins

A reactive protein and gene recombination technology, applied in the field of C-reactive protein, can solve problems such as non-reporting, and achieve the effect of improving accuracy

Pending Publication Date: 2022-07-15
TOYO TOYOBO CO LTD
View PDF9 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is so far no report on the association of such CRP N-terminal structures with antibody-antigen responses in latex immunoturbidimetric assays

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant C-reactive proteins
  • Recombinant C-reactive proteins
  • Recombinant C-reactive proteins

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0129] Example 1 Introduction of mutations and acquisition of transformants

[0130] (1) Introduction of mutation

[0131]Using the artificially synthesized gene of SEQ ID NO: 7 or SEQ ID NO: 8, which is connected with the alkaline phosphatase secretion signal sequence from Escherichia coli (ATGAAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCC) and the mature human CRP sequence of SEQ ID NO: 5 or SEQ ID NO: 6 as a template, the sequence Primers No. 9 and 10 amplify the CRP gene. SEQ ID NO: 9 is a forward primer, and SEQ ID NO: 10 is a reverse primer. Restriction enzyme site NdeI or restriction enzyme site BamHI was added to this primer, respectively. A plasmid was constructed by adding the amplified gene fragment and incubating with a vector plasmid pBluescript KSN(+) cleaved with restriction enzymes NdeI and BamHI, and In-Fusion Reaction Mix (manufactured by Takara Bio). In this way, the recombinant plasmid pBKSN_CRP1 containing SEQ ID NO: 7 and the recombinant ...

Embodiment 2

[0134] Example 2 Expression of CRP gene in Escherichia coli

[0135] The colony of the transformant Escherichia coli JM109 (pBKSN_CRP1) obtained in Example 1 was inoculated into 5 mL of LB liquid medium (containing 1.0% glucose and 100 μg / mL of ampicillin) sterilized in a test tube, and cultured at 37° C. for 16 hours. The obtained culture solution was used as a seed culture solution to inoculate 500 mL of LB liquid medium (containing glycerol 0.5%, calcium chloride 0.05%, IPTG 1 mM, and ampicillin 50 μg / mL) into ten 2-L Sakaguchi flasks, Incubate at 30°C for 24 hours with shaking at 180 rpm. The cells were collected by centrifugation from the end of the culture, suspended in a 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5), crushed by a French press (manufactured by Niro Soavi), and further centrifuged It was separated, and the supernatant liquid was obtained as crude purification liquid 1. Furthermore, crude purification solution 2 was also o...

Embodiment 3

[0136] Example 3 Purification of recombinant CRP

[0137] The crude purified liquid 1 obtained in Example 2 was subjected to affinity purification using Pierce™ p-Aminophenyl PhosphorylCholine Agarose (manufactured by Thermo SCIENTIFIC). The aforementioned resin equilibrated with the buffer used in Example 2 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5) was mixed and adsorbed with the crude purification solution. The resin was washed with the aforementioned buffer, Recombinant CRP solution 1 was obtained by elution with 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM EDTA 2 mM, pH 7.5). The solution was further concentrated to remove EDTA by adding water using a hollow fiber membrane, and at the same time replaced with the buffer used in Example 2 20 mM Tris-HCl buffer (0.14 M sodium chloride, 2 mM calcium chloride, pH 7.5), and further centrifuged It was concentrated to an appropriate concentration with an ultrafiltration filter (manufactu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
wavelengthaaaaaaaaaa
Login to View More

Abstract

In immunoassay using a latex reagent, the correctness of immunoassay in a CRP high-concentration range is improved. The recombinant C-reactive protein is a C-reactive protein produced by gene recombination, and 55% or more of the N-terminus of the C-reactive protein is pyroglutaminated.

Description

technical field [0001] The present invention relates to C-reactive protein (C-reactive protein; hereinafter also shown as "CRP") produced by genetic recombination technology and uses thereof. More specifically, it relates to a recombinant CRP in which the N-terminal structure of CRP is changed, a calibrator using the recombinant CRP, an administration serum, and a method for quantifying CRP by antibody-antigen reaction. Background technique [0002] CRP is a protein that exhibits a precipitation reaction with the C polysaccharide of the pneumococcal capsule, and is also known as a representative inflammatory marker because it is an acute phase protein. In infectious diseases and inflammatory diseases, the blood concentration of CRP is significantly increased, and furthermore, it is rapidly decreased with the recovery of the disease, and the quantification of CRP is used as an indicator for judging the severity of various diseases and for observing treatment. The CRP concent...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/12C07K14/47C12N15/31G01N33/53G01N33/543G01N33/96
CPCC07K14/47G01N33/96C07K2319/02C12R2001/19G01N2333/4737C07K14/4737G01N33/539
Inventor三岛朱加角田洋辅
OwnerTOYO TOYOBO CO LTD