Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Escherichia coli pentamethylene diamine response promoter and application

A technology of Escherichia coli and a promoter, which is applied to Escherichia coli pentamethylenediamine response promoters and application fields, can solve the problems of Escherichia coli difficult physiological activity and the like, and achieve the effect of increasing yield

Pending Publication Date: 2022-07-22
NANJING UNIV OF TECH
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the physical and chemical properties of 1,5-pentanediamine, alkaline and slightly toxic, make it difficult for Escherichia coli to carry out normal physiological activities in high concentrations of pentamethylenediamine

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Escherichia coli pentamethylene diamine response promoter and application
  • Escherichia coli pentamethylene diamine response promoter and application
  • Escherichia coli pentamethylene diamine response promoter and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1 Construction of PcadR-GFP promoter screening plasmid

[0020] PCR amplification was carried out with plasmid PET28a and plasmid Ptrc99a as templates, respectively.

[0021] PET28a used as template:

[0022] The upstream primer has an enzyme cleavage site Nco I , the sequence is as SEQ ID NO.1:

[0023] GACGGAGCTCGAATTTTACTCTTTATCACCCAGCAGTACGGAT;

[0024] Downstream primer with restriction enzyme site Xho I , the sequence is as SEQ ID NO.2:

[0025] AGGAGATATACCATGATGGCCACCCCACACAT;

[0026] Ptrc99a used as template

[0027] The upstream primer has an enzyme cleavage site Nco I , the sequence is shown in SEQ ID NO.3:

[0028] CATGccatggaattcgagctcgg

[0029] Downstream primer with restriction enzyme site Xho I , the sequence is shown in SEQ ID NO.4:

[0030] ccgCTCGAGaaaaggccatccgtcag.

[0031] The reaction conditions were: 95 °C for 2 min, 95 °C for 20 s, 55 °C for 20 s, 72 °C for 10 s, a total of 30 cycles; 72 °C for 5 min. The obtained sequence...

Embodiment 2

[0041] Example 2 Construction of PcadR-PgrcA-GFP plasmid

[0042] Transcriptome analysis of Escherichia coli responsive genes to pentamethylenediamine. Transcriptional analysis methods and results can be found in: Wang X , Guo X , Wang J , et al. Ameliorating end-product inhibition toimprove cadaverine production in engineered Escherichia coli and its application in The synthesis of bio-based diisocyanates[J]. Synthetic andSystems Biotechnology, 2021, 6(4):243-253., obtain the confirmation promoter,

[0043] The nucleotide sequence of the pentamethylenediamine down-regulated promoter PgrcA is shown in SEQ ID No.8:

[0044] TTGCGACCATACTTGATGTGTGGTTTTTATTGATTTAAATCAAAGATTCAAGGGTGTTTGAGGAGTATATATACACTCAAGCAACAATGGTTTTACCAATTGGCCGCGACAGGCTGAACAAATCAAATAATTTTGCCGGGGAGGCATCAC

[0045] The genome of Escherichia coli Trans1-T1 was used as the template, and the upstream and downstream sequences of the promoter were used as primers.

[0046] The upstream primer used has an enzyme cle...

Embodiment 3

[0051] Example 3 Characterization of responsive promoter PgrcA

[0052] The positive strains of Example 2 were inoculated with LB liquid culture containing different pentamethylenediamine concentrations based on 96-well plates, and the LB liquid culture medium was composed of: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 5 g / L , the concentrations of pentamethylenediamine were 0 g / L, 10 g / L, 20 g / L, 30 g / L, and 40 g / L, respectively, and the cells were incubated overnight at 37 °C and 200 rpm with shaking. After 12 hours, the biomass (OD) of the bacteria was measured 600 ) and fluorescence value (GFP), and calculate GFP / OD 600 , and screened out the promoter PgrcA with better response to pentamethylenediamine.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an escherichia coli pentamethylene diamine response promoter and application thereof. Pyruvate carboxylase in corynebacterium glutamicum is synthesized from the beginning and is subjected to heterologous expression in escherichia coli, a pentamethylene diamine response promoter PgrcA and lysine decarboxylase cadA in the escherichia coli are copied through PCR (polymerase chain reaction), and a PcadR-PgrcA-pyc-trc-cadA-rrnB recombinant plasmid is constructed. The plasmid grows well in escherichia coli with high lysine yield, gene expression is stable, glucose is efficiently utilized, pentamethylene diamine can be responded, the fermentation period is short, and byproducts are few. A fermentation result shows that the yield of the pentamethylene diamine of the recombinant escherichia coli KAGPC is remarkably improved compared with that of a control group.

Description

technical field [0001] The invention belongs to the field of strain metabolic transformation, and in particular relates to an Escherichia coli pentamethylenediamine response promoter and application. Background technique [0002] 1,5-Diaminopentane, also known as cadaverine, also known as 1,5-diaminopentane, is a biogenic amine that is ubiquitous in living organisms. 1,5-Pentanediamine has a wide range of applications in industry, agriculture and medicine. In industry, 1,5-pentanediamine can react with dibasic acid to synthesize bio-based polymer polyamide (commonly known as nylon, PA); in agriculture, it can be used for the regulation of plant growth and metabolism, and the improvement of fruit quality and yield ; In medicine, it can be used in medicines for the treatment of dysentery. Currently, the global demand for polyamides is increasing day by day. In addition to the traditional chemical synthesis of 1,5-pentanediamine, biological preparation is also becoming more ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12N15/70C12N15/66C12N15/60C12N15/52C12N1/21C12P13/00C12R1/19
CPCC07K14/245C12N9/88C12N9/93C12Y604/01001C12Y401/01018C12P13/001
Inventor 王静马定廖杨郭元柯杨悦唐意博陈可泉
Owner NANJING UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com