Escherichia coli pentamethylene diamine response promoter and application
A technology of Escherichia coli and a promoter, which is applied to Escherichia coli pentamethylenediamine response promoters and application fields, can solve the problems of Escherichia coli difficult physiological activity and the like, and achieve the effect of increasing yield
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Example 1 Construction of PcadR-GFP promoter screening plasmid
[0020] PCR amplification was carried out with plasmid PET28a and plasmid Ptrc99a as templates, respectively.
[0021] PET28a used as template:
[0022] The upstream primer has an enzyme cleavage site Nco I , the sequence is as SEQ ID NO.1:
[0023] GACGGAGCTCGAATTTTACTCTTTATCACCCAGCAGTACGGAT;
[0024] Downstream primer with restriction enzyme site Xho I , the sequence is as SEQ ID NO.2:
[0025] AGGAGATATACCATGATGGCCACCCCACACAT;
[0026] Ptrc99a used as template
[0027] The upstream primer has an enzyme cleavage site Nco I , the sequence is shown in SEQ ID NO.3:
[0028] CATGccatggaattcgagctcgg
[0029] Downstream primer with restriction enzyme site Xho I , the sequence is shown in SEQ ID NO.4:
[0030] ccgCTCGAGaaaaggccatccgtcag.
[0031] The reaction conditions were: 95 °C for 2 min, 95 °C for 20 s, 55 °C for 20 s, 72 °C for 10 s, a total of 30 cycles; 72 °C for 5 min. The obtained sequence...
Embodiment 2
[0041] Example 2 Construction of PcadR-PgrcA-GFP plasmid
[0042] Transcriptome analysis of Escherichia coli responsive genes to pentamethylenediamine. Transcriptional analysis methods and results can be found in: Wang X , Guo X , Wang J , et al. Ameliorating end-product inhibition toimprove cadaverine production in engineered Escherichia coli and its application in The synthesis of bio-based diisocyanates[J]. Synthetic andSystems Biotechnology, 2021, 6(4):243-253., obtain the confirmation promoter,
[0043] The nucleotide sequence of the pentamethylenediamine down-regulated promoter PgrcA is shown in SEQ ID No.8:
[0044] TTGCGACCATACTTGATGTGTGGTTTTTATTGATTTAAATCAAAGATTCAAGGGTGTTTGAGGAGTATATATACACTCAAGCAACAATGGTTTTACCAATTGGCCGCGACAGGCTGAACAAATCAAATAATTTTGCCGGGGAGGCATCAC
[0045] The genome of Escherichia coli Trans1-T1 was used as the template, and the upstream and downstream sequences of the promoter were used as primers.
[0046] The upstream primer used has an enzyme cle...
Embodiment 3
[0051] Example 3 Characterization of responsive promoter PgrcA
[0052] The positive strains of Example 2 were inoculated with LB liquid culture containing different pentamethylenediamine concentrations based on 96-well plates, and the LB liquid culture medium was composed of: peptone 10 g / L, yeast powder 5 g / L, sodium chloride 5 g / L , the concentrations of pentamethylenediamine were 0 g / L, 10 g / L, 20 g / L, 30 g / L, and 40 g / L, respectively, and the cells were incubated overnight at 37 °C and 200 rpm with shaking. After 12 hours, the biomass (OD) of the bacteria was measured 600 ) and fluorescence value (GFP), and calculate GFP / OD 600 , and screened out the promoter PgrcA with better response to pentamethylenediamine.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com