Genetically engineered bacterium EC01 S7 for co-production of 3-hydracrylic acid and 1, 3-propylene glycol as well as construction method and application of genetically engineered bacterium EC01 S7

A technology of genetically engineered bacteria and hydroxypropionic acid, applied in the field of bioengineering, can solve problems such as redox state imbalance, accumulation of toxic 3-hydroxypropanal, and insufficient activity, and achieve the effect of high-efficiency co-production

Pending Publication Date: 2022-07-29
JIANGSU UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

On the one hand, the activity of propionaldehyde dehydrogenase and 1,3-propanediol oxidoreductase / isoenzyme used for the production of 3-hydroxypropionic acid and 1,3-propanediol is insufficient, and it is easy to accumulate toxic 3-hydroxypropionaldehyde and damage Cell growth and enzyme activity; on the other hand, the synthesis of 3-hydroxypropionate requires the oxidized coenzyme NAD + , and the production of 1,3-propanediol requires the reduced coenzyme NAD(P)H, so the production of 3-hydroxypropionic acid or 1,3-propanediol alone will cause an imbalance in the intracellular redox state, affecting the normal metabolism of cells and 3-hydroxypropanediol Acid and 1,3-propanediol production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Genetically engineered bacterium EC01 S7 for co-production of 3-hydracrylic acid and 1, 3-propylene glycol as well as construction method and application of genetically engineered bacterium EC01 S7
  • Genetically engineered bacterium EC01 S7 for co-production of 3-hydracrylic acid and 1, 3-propylene glycol as well as construction method and application of genetically engineered bacterium EC01 S7
  • Genetically engineered bacterium EC01 S7 for co-production of 3-hydracrylic acid and 1, 3-propylene glycol as well as construction method and application of genetically engineered bacterium EC01 S7

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1: Construction of glycerol dehydratase and its reactivation factor (DhaB123-GdrAB) recombinant plasmid

[0042] (1) According to the Klebsiella pneumoniae glycerol dehydratase and its reactivation factor DhaB123-GdrAB gene sequence, primers were designed using Oligo7.0 software:

[0043] DhaB F: GTTTAACTTTAATAAGGAGATATACCatgaaaagatcaaaacgatttgcagtactg (SEQ ID No: 15);

[0044] GdrA R: CGGCCCCCTCGTTAACACttaattcgcctgaccggccag (SEQ ID No: 16);

[0045] GrdB F: CTGGCCGGTCAGGCGAATTAAgtgttaacgagggggccgtc (SEQ ID No: 17);

[0046] GrdB R: TTATGCGGCCGCAAGCTTGTCGACtcagtttctctcacttaacggcaggac (SEQ ID No: 18).

[0047] (2) Amplify DhaB123-GdrA gene using DhaB F and GdrA R primer pair, and amplify GdrB gene using GdrB F and GdrB R primer pair, PCR reaction parameters: pre-denaturation, 98℃ for 3min; denaturation, 98℃ for 10s; annealing, 55°C for 10s; extension, 72°C for 1.5 min; final extension, 72°C for 5 min; DhaB123-GdrA gene and GdrB gene were obtained after 33 cycl...

Embodiment 2

[0052] Embodiment 2: the construction of genetically engineered bacteria producing 3-hydroxypropionic acid or 1,3-propanediol

[0053] (1) According to the gene sequences of propionaldehyde dehydrogenase PuuC and GabD4, the gene sequences of 1,3-propanediol oxidoreductase isoenzyme YqhD, 1,3-propanediol oxidoreductase PduQ, and the sequence characteristics of the pETDuet-1 plasmid, use Oligo7.0 software designed primers. Wherein, the nucleotide sequence of PuuC is shown in SEQ ID No:3, and the amino acid sequence is shown in SEQ ID No:4; the nucleotide sequence of GabD4 is shown in SEQ ID No:5, and the amino acid sequence is shown in SEQ ID No:5. Shown in SEQ ID No:6; the nucleotide sequence of YqhD is shown in SEQ ID No:7, and the amino acid sequence is shown in SEQ ID No:8; the nucleotide sequence of PduQ is shown in SEQ ID No:9 As shown, the amino acid sequence is shown in SEQ ID No:10.

[0054] The designed primer sequences are as follows:

[0055] PuuCF F: GTTTAACTTTAA...

Embodiment 3

[0070] Example 3: Construction of genetically engineered bacteria co-producing 3-hydroxypropionic acid and 1,3-propanediol:

[0071] (1) According to the recombinant plasmid pS3 sequence and YqhD gene sequence, use Oligo7.0 software to design primers:

[0072] Backbone1 F: attagttaagtataagaaggatatacat (SEQ ID No: 27);

[0073] Backbone1 F: gtggcagcagcctaggttaa (SEQ ID No: 28);

[0074] YqhD2 F: ATTAGTTAAGTATAAGAAGGAGATATACATatgaacaactttaatctgcacac (SEQ ID No: 29);

[0075] YqhD2 R: GTGGCAGCAGCCTAGGTTAAttagcgggcggcttcgtat (SEQ ID No: 30).

[0076] (2) Using the recombinant plasmid pS2 as a template, use primer pairs Backbone1 F and Backbone1 R to amplify to obtain a linearized pS2 backbone, use YqhD2 F and YqhD2 R primer pairs to amplify the YqhD gene on the recombinant plasmid pS3, and use Gibson to assemble at 50 The YqhD gene was connected to the linearized pS2 backbone by reacting at ℃ for 30 min to obtain a recombinant plasmid that co-expressed GabD4 and YqhD.

[0077]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a genetically engineered bacterium EC01S7 for co-production of 3-hydracrylic acid and 1, 3-propylene glycol as well as a construction method and application of the genetically engineered bacterium EC01S7, and belongs to the technical field of bioengineering. In the invention, genetic engineering and synthetic biological technologies are utilized to screen and cooperatively express high-activity aldehyde dehydrogenase and 1, 3-propylene glycol oxidoreductase isoenzyme to share the burden of metabolizing 3-hydroxypropionaldehyde, and then the yield of 3-hydroxypropionic acid and 1, 3-propylene glycol is increased by optimizing the expression of GabD4 and YqhD. Finally, pyridine nucleotide transhydrogenase is regulated and controlled through coenzyme engineering to improve circulating supply of coenzymes NAD < + > and NADPH, and then deep synthesis of 3-hydracrylic acid and 1, 3-propylene glycol is promoted; the genetically engineered bacterium for efficient co-production of 3-hydracrylic acid and 1, 3-propylene glycol relieves accumulation of toxic intermediate metabolite 3-hydroxypropionaldehyde, realizes self-sufficiency of coenzyme in cells, and realizes efficient production of 3-hydracrylic acid and 1, 3-propylene glycol.

Description

technical field [0001] The invention belongs to the technical field of bioengineering, and in particular relates to a genetically engineered bacterium EC01 S7 for co-producing 3-hydroxypropionic acid and 1,3-propanediol, a construction method and application. Background technique [0002] 3-Hydroxypropionic acid and 1,3-propanediol are two industrially important platform compounds that are widely used as precursors of biodegradable polymers and food additives. 3-Hydroxypropionic acid and 1,3-propanediol are produced by chemical synthesis and biological methods. Most of the chemical methods use non-renewable resources as raw materials. The production process consumes a lot of energy, and the products and by-products are difficult to separate and purify. The production process produces immeasurable environmental pollution. Biosynthesis of 3-hydroxypropionic acid or 1,3-propanediol mostly uses glucose and glycerol as substrates, and glycerol is used as a substrate to produce 3...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/70C12N15/60C12N15/53C12R1/19
CPCC12P7/42C12P7/18C12N15/70C12N15/52C12N9/88C12N9/0008C12N9/0006C12N9/0036C12Y402/0103C12Y102/01C12Y101/01202C12Y106/01001
Inventor齐向辉张宇飞员君华窦媛赵梅翟彼得
OwnerJIANGSU UNIV