3D-DNA nano-motor sensor triggered by bispecific aptamer and application of 3D-DNA nano-motor sensor in lysozyme detection
A dual-specificity, lysozyme technology, applied in the field of lysozyme detection, can solve the problems of low reaction rate and poor signal accumulation ability, and achieve the effect of improving sensitivity, improving structural stability, and avoiding the influence of sensor performance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0048] Example 1: Preparation of gold nanoparticles with a diameter of 15 nm
[0049] First, 1 mL of 1% chloroauric acid aqueous solution was added to a three-necked round-bottomed flask containing 98 mL of ultrapure water, stirred vigorously and heated to boil in an oil bath. Then 1 mL of 5% trisodium citrate aqueous solution was rapidly added, and after 30 min of reaction, the color of the solution gradually changed from light yellow to dark wine red. Finally, the round-bottomed flask was transferred to room temperature, cooled to room temperature with stirring, and then the prepared AuNPs solution was stored at 4 °C in the dark for future use.
[0050] The morphology and size of gold nanoparticles were determined by transmission electron microscopy (TEM) and dynamic light scattering. figure 2 shown. The prepared gold nanoparticles were uniform in size and had an average particle size of 15 nm.
Embodiment 2
[0051] Example 2: Preparation of two DNA functionalized gold nanoparticles
[0052] The 3D-DNA nanomotor sensor mainly contains two kinds of DNA-functionalized gold nanoparticles.
[0053] (1) For the preparation of DNA-functionalized gold nanoparticles (AuNPs@Th) used in the walking process: before functionalization, mix 100 μL of 4 μM orbital hairpin (Th) with 10 μL of 20 mM TCEP at 25°C 2h to cleave the disulfide bond to obtain the Th solution. Then, the Th solution was heated at 95 °C for 10 min and then slowly cooled on ice to obtain a stable hairpin structure. Next, after adding 500 μL of AuNPs (1.79 nM) prepared in Example 1 and shaking well, PBS buffer (10×) was added dropwise to the above solution until a concentration of 0.05 M NaCl was reached. The NaCl concentration was then increased to 0.5M in 0.1M NaCl increments using 2M NaCl at 8 hour intervals, while maintaining the Tween-20 concentration at 0.05% during the "aging" process. Finally, AuNPs@Th were obtain...
Embodiment 3
[0063] Example 3: Construction of Y-type bispecific aptamer
[0064] Equal volumes of Y-a chain, Y-b chain and two aptamers (Ly-1 and Ly-2) with different binding sites for lysozyme were first mixed. The mixture was heated to 95°C for 5 minutes, then slowly cooled to 37°C for 1-3 hours to construct 2 μM Y-type bispecific aptamer. Verified by native polyacrylamide gel electrophoresis (PAGE), such as Figure 4 As shown, a new band with slower mobility appeared in lane 8, indicating the successful construction of the Y-type bispecific aptamer.
[0065] Nucleotide sequence of Y-a (5'-3', SEQ ID NO. 5):
[0066] ACGACAGAGGTCAGATGCCTATGCGTGCTACCGTGAACGGCACCCATGTAAGCTTCGTCCTGTCTG;
[0067] Nucleotide sequence of Y-b (5'-3', SEQ ID NO. 6):
[0068] TGCCATCAAAACCTCTGTCAGCGATCCGTTCACGGTAGCACGCATAGGCATCTGACCTCTGTCGT.
[0069] Nucleotide sequence of Ly-1 (5'-3', SEQ ID NO. 7):
[0070] GGGAATGGATCCACATCTACGAATTCATCAGGGCTAAAGAGTGCAGAGTTACTTAGTTCACTGCAGACTTGACGAAGCTT;
[0071] Nucl...
PUM
| Property | Measurement | Unit |
|---|---|---|
| volume | aaaaa | aaaaa |
| diameter | aaaaa | aaaaa |
| particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More