Unlock instant, AI-driven research and patent intelligence for your innovation.

Gama-tocopherol methyl transferase gene, its coding vector and uses

A phenol methyl and transferase technology, applied in the field of plant genetic engineering, can solve problems such as changing the distribution of α-tocopherol

Inactive Publication Date: 2006-07-26
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF0 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although this assumption has been confirmed, there is no new γ-TMT gene isolated and cloned from major oil crops and transformed into oil crops to increase the content of α-tocopherol and change the distribution of α-tocopherol. to report

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gama-tocopherol methyl transferase gene, its coding vector and uses
  • Gama-tocopherol methyl transferase gene, its coding vector and uses
  • Gama-tocopherol methyl transferase gene, its coding vector and uses

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0059] Example 1 Cloning of maize γ-tocopherol methyltransferase gene

[0060] 1.1 Extraction of total RNA

[0061] The extraction of total RNA was carried out according to the RNAgents Total RNA Isolation System kit of Promega Company. Get 1g of leaves of No. 115 high-oil corn that has grown for 20 days and grind it into powder in liquid nitrogen, add it to ice-precooled 600L denaturation solution (26mmol / L sodium acetate, 0.5% lauryl sarcosine pH4.0, 0.125 mol / L β-mercaptoethanol, 4mol / L guanidinium thiocyanate), and then sequentially add 60L 2mol / L sodium acetate (pH4.0), mix well, add 600L phenol: chloroform: isoamyl alcohol (25:24: 1, pH4.7), shake vigorously, place on ice for 15min, centrifuge at 10000g for 20min at 4°C, aspirate the supernatant, add an equal volume of isopropanol, place at -20°C for 30min, centrifuge at 10000g for 10min at 4°C, discard Remove the supernatant, add 1 mL of ice-cold 75% ethanol to the precipitate and wash it, dry the precipitated RNA nat...

Embodiment 2

[0078] Example 2 Cloning of soybean gamma-tocopherol methyltransferase gene

[0079] 2.1 Extraction of total RNA

[0080] A 20-day-grown soybean variety (Zheng 9525) was selected to extract total RNA, and the first strand of reverse-transcribed cDNA was obtained by the above-mentioned method 1.1.

[0081] 2.2 Rapid amplification of cDNA 3' end

[0082] After obtaining the first strand of cDNA, design the 5'-end primer S-TMT1 according to the conserved sequence in the γ-TMT gene from Arabidopsis: 5'TAGTGGATGTTGGGTGTGG, Oligo (dT) as the 3'-end primer, and carry out cDNA 3' Amplification of the ends. The PCR amplification conditions were: 94° C. for 4 min, 94° C. for 1 min, 55° C. for 45 s, 72° C. for 45 s (30 cycles), and 72° C. for 10 min. A fragment of about 600bp was amplified, recovered and connected to the pGM-T Easy vector to construct the recombinant plasmid pT-3'SoyTMT, and transform it into E.coli DH5α, identify it by enzyme digestion, and sequence after obtaining a...

Embodiment 3

[0088] Example 3 Construction and Induced Expression Containing γ-TMT Gene Prokaryotic Expression Vector

[0089] 3.1 Removal of endogenous signal peptide

[0090] The amino acid sequence deduced by software analysis found that there is a peptide guide sequence at the N-terminus of maize γ-TMT that locates the protein on the chloroplast membrane. In order to make the γ-TMT gene express correctly in the prokaryotic and obtain an active protein, we Design primer MTMTsig at the 5' end according to its gene sequence: 5'CCCGGGGCCTCGTCGACGGCTCAGG (with a SmaI restriction site at the 5' end), and perform PCR reaction with MaiP2: 5'gagctcCTACGCGGCTCCAGGCTTGCGAC (with a SacI restriction site at the 5' end) (Using plasmid pT-MTMTcDNA as a template) to remove the chloroplast guide peptide sequence, the reaction conditions are: 94°C for 4min, 94°C for 1min, 58°C for 45s, 72°C for 1min (30 cycles), 72°C for 10min. The amplified product was 916bp. After recovery, it was cloned on the pGM-T...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

This invention discloses a gamma- tocopherol methyl transfer enzyme that from corn and soybean, their code gene and their use in the plant gene project field. This invention uses RACE and RT-PCR technique, it obtains the span cDNA code sequence of gamma- tocopherol methyl transfer enzyme showed by the SEQ ID NO: 1 and SEQ ID NO: 3 from the corn of high oil 115 and soybean (9525) which all belongs to the oil plants, and it obtains the gamma- tocopherol methyl transfer enzyme with biological activity through prokaryotes expression, and it also compares with the difference of gamma-TMT enzyme activity form different sources. This invention transforms the pattern plant from the related code sequence, through HPLC analysis, the content of the alpha- tocopherol of the transfer gene plant leafage is improved by 2-5 times comparing to that of the wild leafage. This invention is to cut a new way for culturing the new plant of oil plants with high vitamin E content.

Description

technical field [0001] The invention relates to a gene encoding γ-tocopherol methyltransferase, in particular to the isolated and cloned γ-tocopherol methyltransferase gene of oil crops corn and soybean, its expression vector and its application, and belongs to the field of plant genetic engineering. Background technique [0002] Vitamin E is a fat-soluble vitamin necessary for the human body and has important physiological functions. It can scavenge the free radicals produced by lipid peroxidation to stabilize the lipid bilayers of biological membranes and protect cells from peroxide damage (Brigeliusb-flohE R, Traber MG, Vitamin E: function and metablism, The FASEB J, 1999, 13, 1145-1155). Therefore, it is widely used as an effective antioxidant in medicine, food, feed and other industries. A large number of animal experiments have proved that adding 40-100 IU (international unit) of vitamin E per kilogram of feed can improve animal immunity, improve meat quality, improv...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/63C12N15/82C12N1/21
Inventor 张伟王磊范云六
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI