Gama-tocopherol methyl transferase gene, its coding vector and uses
A phenol methyl and transferase technology, applied in the field of plant genetic engineering, can solve problems such as changing the distribution of α-tocopherol
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0059] Example 1 Cloning of maize γ-tocopherol methyltransferase gene
[0060] 1.1 Extraction of total RNA
[0061] The extraction of total RNA was carried out according to the RNAgents Total RNA Isolation System kit of Promega Company. Get 1g of leaves of No. 115 high-oil corn that has grown for 20 days and grind it into powder in liquid nitrogen, add it to ice-precooled 600L denaturation solution (26mmol / L sodium acetate, 0.5% lauryl sarcosine pH4.0, 0.125 mol / L β-mercaptoethanol, 4mol / L guanidinium thiocyanate), and then sequentially add 60L 2mol / L sodium acetate (pH4.0), mix well, add 600L phenol: chloroform: isoamyl alcohol (25:24: 1, pH4.7), shake vigorously, place on ice for 15min, centrifuge at 10000g for 20min at 4°C, aspirate the supernatant, add an equal volume of isopropanol, place at -20°C for 30min, centrifuge at 10000g for 10min at 4°C, discard Remove the supernatant, add 1 mL of ice-cold 75% ethanol to the precipitate and wash it, dry the precipitated RNA nat...
Embodiment 2
[0078] Example 2 Cloning of soybean gamma-tocopherol methyltransferase gene
[0079] 2.1 Extraction of total RNA
[0080] A 20-day-grown soybean variety (Zheng 9525) was selected to extract total RNA, and the first strand of reverse-transcribed cDNA was obtained by the above-mentioned method 1.1.
[0081] 2.2 Rapid amplification of cDNA 3' end
[0082] After obtaining the first strand of cDNA, design the 5'-end primer S-TMT1 according to the conserved sequence in the γ-TMT gene from Arabidopsis: 5'TAGTGGATGTTGGGTGTGG, Oligo (dT) as the 3'-end primer, and carry out cDNA 3' Amplification of the ends. The PCR amplification conditions were: 94° C. for 4 min, 94° C. for 1 min, 55° C. for 45 s, 72° C. for 45 s (30 cycles), and 72° C. for 10 min. A fragment of about 600bp was amplified, recovered and connected to the pGM-T Easy vector to construct the recombinant plasmid pT-3'SoyTMT, and transform it into E.coli DH5α, identify it by enzyme digestion, and sequence after obtaining a...
Embodiment 3
[0088] Example 3 Construction and Induced Expression Containing γ-TMT Gene Prokaryotic Expression Vector
[0089] 3.1 Removal of endogenous signal peptide
[0090] The amino acid sequence deduced by software analysis found that there is a peptide guide sequence at the N-terminus of maize γ-TMT that locates the protein on the chloroplast membrane. In order to make the γ-TMT gene express correctly in the prokaryotic and obtain an active protein, we Design primer MTMTsig at the 5' end according to its gene sequence: 5'CCCGGGGCCTCGTCGACGGCTCAGG (with a SmaI restriction site at the 5' end), and perform PCR reaction with MaiP2: 5'gagctcCTACGCGGCTCCAGGCTTGCGAC (with a SacI restriction site at the 5' end) (Using plasmid pT-MTMTcDNA as a template) to remove the chloroplast guide peptide sequence, the reaction conditions are: 94°C for 4min, 94°C for 1min, 58°C for 45s, 72°C for 1min (30 cycles), 72°C for 10min. The amplified product was 916bp. After recovery, it was cloned on the pGM-T...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com