Regulation protein SnpR and its gene and application
A technology for regulating proteins and genes, which is used in applications, genetic engineering, plant genetic improvement, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Example 1 PCR amplification and sequencing results of doxA gene and snpR+snpA
[0037] Using the published Streptomyces coelicolor SIPI-1482 genome as a template, the doxA gene was amplified by 97°C for 5 minutes, 95°C for 30 seconds, 72°C for 5 minutes, 30 cycles, and 72°C for 10 minutes to amplify a single target The stripe is about 1.3Kb in size. The amplification of snpR+snpA uses gradient PCR, and the designed primers are:
[0038] Forward primer: CG GAATTC GCGCATCGATGACTCCTCGAG (underlined as EcoRI),
[0039] Reverse primer: AA CTGCAG GTACCGCCGACCCGCTGCAT (PstI is underlined). The annealing temperatures were 62.8°C, 65.5°C, and 68°C, respectively. It can be seen from Figure 1 that no target band was amplified at 62.8°C. To enhance the specificity of amplification, annealing at 68°C was used.
[0040]The above-mentioned doxA gene containing ribosome binding sites was sequenced, and it was found that its sequence was 100% homologous to the sequence reported i...
Embodiment 2
[0041] Example 2 Recombinant plasmid construction, enzyme digestion verification and PCR inspection
[0042] The above doxA, snpA and SnpR gene sequences were cloned into pUC18. The doxA, snpA and SnpR fragments excised from it were subcloned into the plasmid pBluescript II KS(-), and then the tandem fragment (PstI-HindIII fragment) was combined with the vector pYG57 containing the thiostrepton (tsr) resistance gene (PstI-HindIII large fragment) was ligated to construct recombinant plasmid pYG908, transform TK24 protoplasts, and 2 Positive clones were screened on YE medium to obtain the expression vector of the present invention and the genetically engineered bacteria pYG908 / TK24. The construction process of the recombinant plasmid pYG908 is shown in FIG. 2 .
[0043] The fragments of snpR+snpA and doxA, as well as the tandem fragments of the two, can be excised with corresponding enzymes for the recombinant plasmid pYG908 (Fig. 3). By diluting the recombinant plasmid as a t...
Embodiment 3
[0049] Example 3 Expression of recombinant protein
[0050] Insert the genetically engineered bacteria pYG908 / TK24 into YMB medium (see the Streptomyces operation manual for the recipe) 20ml (+tsr 30μg / ml), 30°C, 250r / min shaker culture for 2d as seeds, and then 10 (v / v) After the % inoculum is inserted into the above-mentioned medium, continue to cultivate for 2 days, collect the mycelium by centrifugation (10000r / min, 10min), wash the mycelium with 100mmol / L phosphate buffer (pH7.5), and then sonicate Break up (work for 5s, stop for 5s, cycle 80 times), collect supernatant after centrifugation, and use for SDS-PAGE protein electrophoresis analysis.
[0051] As shown in Figure 5, from the analysis of the results of mycelium protein electrophoresis, it can be known that the genetically engineered bacteria pYG908 / TK24 produced a band of about 47kD, the size and the theoretical daunorubicin C-14 hydroxylase gene encoding 423 amino acids The size of 46.7k D is similar to that o...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More