Cotton pachytene chromosome fluorescence in-situ hybridization method

A technique of fluorescence in situ hybridization and pachytene, applied in the fields of cytogenetics and molecular biology, to achieve the effect of improving detection efficiency and resolution

Inactive Publication Date: 2010-04-07
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Most of the target DNAs used in fluorescence in situ hybridization of cotton are somatic cells or meiotic metaphase chromosomes, and there is no report on the use of pachytene chromosomes as target DNA in cotton fluorescence in situ hybridization.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton pachytene chromosome fluorescence in-situ hybridization method
  • Cotton pachytene chromosome fluorescence in-situ hybridization method
  • Cotton pachytene chromosome fluorescence in-situ hybridization method

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0029] 2. Probe preparation

[0030] The probe selected by signal multiple amplification fluorescence in situ hybridization is EST sequence G1185, the gene bank number is CA994275, and the primers designed by Oligo6 software are:

[0031] 5'GGATTATGAATGGCGACAAG3' (upstream primer, SEQ ID NO: 1),

[0032] 5'TTTAGAAATCTTCCTCCGTT3' (downstream primer, SEQ ID NO: 2), the length of the PCR product is 934bp;

[0033] The probes selected by two-color fluorescence in situ hybridization were 18S rDNA and 5S rDNA genes, and the primers were designed using Oligo6 software. The primers designed for the 18S rDNA gene were:

[0034] 5'TGTGAAACTGCGAATGGCTC3' (upstream primer, SEQ ID NO: 3),

[0035] 5'ACAAAGGGCAGGGACGTAGT3' (downstream primer, SEQ ID NO: 4), the length of the PCR product is 1500bp;

[0036] The primers designed for the 5S rDNA gene are:

[0037] 5'GAGAGTAGTACAACGATGGG3' (upstream primer, SEQ ID NO: 5),

[0038] 5'GGAGTTCTGATGGGATCCGG3' (downstream primer, SEQ ID NO: 6),...

example 1

[0044] Example 1 Signal Multiplex Amplified Fluorescence In Situ Hybridization

[0045]Before hybridization, dry the prepared sheet in an oven at 60°C overnight; add a few drops of 100 μg / μL DNase-free RNase, cover the sheet, and treat it at 37°C for 1 hour, and use 2×SSC (0.3mol / L NaCl and 0.03mol / L trisodium citrate) buffer solution, rinse the coverslip with 2×SSC buffer solution, and wash the preparation piece with 2×SSC buffer solution for 3×5 minutes (washing 3 times, 5 minutes each time); drop Add a few drops of 0.01% (suitable for somatic cells) or 1% (suitable for pollen mother cells) Pepsin (prepared in 10mM HCl), cover the cover slip, incubate at 37°C for 1 hour, rinse the cover slip with 2×SSC buffer, 2× SSC buffer was washed for 2×5 minutes; 2% PVP40 and 4g / L of active carbon were treated for 1 hour, and 2×SSC buffer was washed for 3×5 minutes; 4% paraformaldehyde (50mM MgCl 2 1 × PBS preparation) fixed at 37°C for 10 minutes; washed with 2 × SSC buffer for 3 × 5 ...

example 2

[0049] Example 2 Two-color fluorescence in situ hybridization

[0050] Before hybridization, dry the prepared slices in an oven at 60°C overnight; add a few drops of 100 μg / μL DNase-free RNase (prepared in 2×SSC buffer), cover with a cover slip, and treat at 37°C for 1 hour, 2×SSC buffer Rinse off the cover slip, wash with 2×SSC for 3×5 minutes; add a few drops of 1% Pepsin (prepared in 10mM HCl), cover the cover slip, incubate at 37°C for 1 hour, rinse the cover slip with 2×SSC buffer, 2 × SSC buffer wash 2 × 5 minutes; transfer to 4% paraformaldehyde (50mM Mgcl 2 1 × PBS preparation) fixed at 37 ° C for 10 minutes; 2 × SSC buffer wash 3 × 5 minutes; quickly transferred to 70%, 90%, 100% ethanol gradient dehydration step by step for 3 minutes, air-dried slides.

[0051] The hybridization mixture must be newly prepared before use, and its composition is as follows: 50% deionized formamide (used to prevent damage and shedding of chromosome shape and structure caused by high t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescent home position hybrid technique, which is characterized by the following: adopting chromosome in the pachytene as target DNA to proceed fluorescent home position hybrid; drawing high-density physical atlas; fitting for separating cloning order gene; measuring sequence of full genome of cotton; improving the locating measuring efficiency of functional gene and molecular mark for cotton effectively; adopting chromosome in the pachytene with two homologous chromosomes to avoid the identifying defect; improving distinguishing efficiency greatly.

Description

technical field [0001] The invention relates to the fields of cytogenetics and molecular biology, in particular to the fluorescent in situ hybridization technique (FISH) of cotton pachytene chromosomes. Background technique [0002] Generally speaking, the development of chromosomal fluorescence in situ hybridization (FISH) mainly advances along two routes: on the one hand, different probes are used, from FISH with genome as probe to repeat sequence as probe. FISH has developed to FISH using BAC, YAC, and cosmid libraries as probes, and then to FISH using low-copy or single-copy DNA sequences as probes; on the other hand, efforts are being made to improve the resolution of FISH technology and target From metaphase chromosomes (including somatic cells and meiotic metaphase chromosomes, resolution of 1-3Mb) to meiotic pachytene chromosomes (resolution of 50-100kb), and then to DNA fibers (resolution of several kb), making its resolution developed from several Mb to several kb...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/68G01N21/64C12N15/11
Inventor王坤波宋国立张涛王春英刘方黎绍惠张香娣
OwnerINST OF COTTON RES CHINESE ACAD OF AGRI SCI