Cotton pachytene chromosome fluorescence in-situ hybridization method
A technique of fluorescence in situ hybridization and pachytene, applied in the fields of cytogenetics and molecular biology, to achieve the effect of improving detection efficiency and resolution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0029] 2. Probe preparation
[0030] The probe selected by signal multiple amplification fluorescence in situ hybridization is EST sequence G1185, the gene bank number is CA994275, and the primers designed by Oligo6 software are:
[0031] 5'GGATTATGAATGGCGACAAG3' (upstream primer, SEQ ID NO: 1),
[0032] 5'TTTAGAAATCTTCCTCCGTT3' (downstream primer, SEQ ID NO: 2), the length of the PCR product is 934bp;
[0033] The probes selected by two-color fluorescence in situ hybridization were 18S rDNA and 5S rDNA genes, and the primers were designed using Oligo6 software. The primers designed for the 18S rDNA gene were:
[0034] 5'TGTGAAACTGCGAATGGCTC3' (upstream primer, SEQ ID NO: 3),
[0035] 5'ACAAAGGGCAGGGACGTAGT3' (downstream primer, SEQ ID NO: 4), the length of the PCR product is 1500bp;
[0036] The primers designed for the 5S rDNA gene are:
[0037] 5'GAGAGTAGTACAACGATGGG3' (upstream primer, SEQ ID NO: 5),
[0038] 5'GGAGTTCTGATGGGATCCGG3' (downstream primer, SEQ ID NO: 6),...
example 1
[0044] Example 1 Signal Multiplex Amplified Fluorescence In Situ Hybridization
[0045]Before hybridization, dry the prepared sheet in an oven at 60°C overnight; add a few drops of 100 μg / μL DNase-free RNase, cover the sheet, and treat it at 37°C for 1 hour, and use 2×SSC (0.3mol / L NaCl and 0.03mol / L trisodium citrate) buffer solution, rinse the coverslip with 2×SSC buffer solution, and wash the preparation piece with 2×SSC buffer solution for 3×5 minutes (washing 3 times, 5 minutes each time); drop Add a few drops of 0.01% (suitable for somatic cells) or 1% (suitable for pollen mother cells) Pepsin (prepared in 10mM HCl), cover the cover slip, incubate at 37°C for 1 hour, rinse the cover slip with 2×SSC buffer, 2× SSC buffer was washed for 2×5 minutes; 2% PVP40 and 4g / L of active carbon were treated for 1 hour, and 2×SSC buffer was washed for 3×5 minutes; 4% paraformaldehyde (50mM MgCl 2 1 × PBS preparation) fixed at 37°C for 10 minutes; washed with 2 × SSC buffer for 3 × 5 ...
example 2
[0049] Example 2 Two-color fluorescence in situ hybridization
[0050] Before hybridization, dry the prepared slices in an oven at 60°C overnight; add a few drops of 100 μg / μL DNase-free RNase (prepared in 2×SSC buffer), cover with a cover slip, and treat at 37°C for 1 hour, 2×SSC buffer Rinse off the cover slip, wash with 2×SSC for 3×5 minutes; add a few drops of 1% Pepsin (prepared in 10mM HCl), cover the cover slip, incubate at 37°C for 1 hour, rinse the cover slip with 2×SSC buffer, 2 × SSC buffer wash 2 × 5 minutes; transfer to 4% paraformaldehyde (50mM Mgcl 2 1 × PBS preparation) fixed at 37 ° C for 10 minutes; 2 × SSC buffer wash 3 × 5 minutes; quickly transferred to 70%, 90%, 100% ethanol gradient dehydration step by step for 3 minutes, air-dried slides.
[0051] The hybridization mixture must be newly prepared before use, and its composition is as follows: 50% deionized formamide (used to prevent damage and shedding of chromosome shape and structure caused by high t...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap