Cochleate compositions directed against expression of proteins

Inactive Publication Date: 2005-01-20
BIODELIVERY SCI +1
View PDF28 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

[0220] Another advantage of the present invention is the ability to modulate cochleate size. Modulation of the size of cochleates can change the manner in which the siRNA, morpholino and / or additional cargo moiety is taken up by cells. For example, in general, small cochleates are taken up quickly and efficiently into cells, whereas larger cochleates are taken up more slowly, but tend to retain efficacy for a longer period of time. Also, in some cases small cochleates are more effective than large cochleates in certain cells, while in other cells large cochleates are more effective than small cochleates.
[0222] In another aspect, the present invention provides for both prophylactic and therapeutic methods of treating a subject at risk of (or susceptible to) a disorder or having a disorder associated with aberrant or unwanted target gene expression or activity. The method generally includes administering to a subject a therapeutically effective amount of a morpholino-cochleate composition or siRNA-cochleate of the invention such that the disease or disorder is treated.
[0223] The present invention provides a method for treating a subject that would benefit from administration of a composition of the present invention. Any therapeutic indication that would benefit from the cochleate compositions of the present invention can be treated by the methods of the invention. The method includes the step of administering to the subject a composition of the invention, such that the disease or disorder is treated.
[0224] With regard to both prophylactic and therapeutic methods of treatment, such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics. “Pharmacogenomics,” as used herein, refers to the application of genomics technologies such as gene sequencing, statistical genetics, and gene expression analysis to drugs in clinical development and on the market. More specifically, the term refers the study of how a patient's genes determine his or her response to a drug (e.g., a patient's “drug response phenotype,” or “drug response genotype”). Thus, another aspect of the invention provides methods for tailoring an individual's prophylactic or therapeutic treatment with either the target gene molecules of the present invention or target gene modulators according to that individual's drug response genotype. Pharmacogenomics allows a clinician or physician to target prophylactic or therapeutic treatments to patients who will most benefit from the treatment and to avoid treatment of patients who will experience toxic drug-related side effects.
[0225] The language “therapeutically effective amount” is that amount necessary or sufficient to produce a desired physiologic response. The effective amount may vary depending on such factors as the size and weight of the subject, or the particular compound. The effective amount may be determined through consideration of the toxicity and therapeutic efficacy of the compounds by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it may be expressed as the ratio LD50 / ED50. Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to unaffected cells and, thereby, reduce side effects.
[0226] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any composition used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the EC50 (i.e., the concentration of the test composition that achieves a half-maximal response) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

Problems solved by technology

An obstacle to the realization of the full potential of gene therapy is the development of safe and effective means for delivering siRNA to cells and organisms.
While the potential of antisense is widely recognized, there are numerous limitations to the use of antisense currently available.
One of the key limiting aspects of this strategy is poor cell penetration.
However, the penetration of the endosomal barrier is a pre-requisite event for antisense activity and the naked antisense oligonucleotides do not appear to do this in great extent.
Although complexes of antisense oligonucleotides with cationic liposomes, in some instances, have enhanced intracellular delivery, they have come with a disadvantage, cytotoxicity.
Their utility in vitro and in vivo has also been limited by their lack of stability in serum and their inflammatory properties.
Scraping the cells causes damage to the membrane, thereby reducing the viability of the cell population and ultimately altering the cellular characteristics of the remaining viable cells.
The second method, the “special delivery vehicle” supplied with the morpholino, requires dramatic changes in pH that result in very low efficacy.
The low efficacy of the “special delivery vehicle” may be due to cytotoxicity or other changes to the cells.
The above methods are not translatable to in vivo delivery because they involve compromise of the target cells and pH changes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cochleate compositions directed against expression of proteins
  • Cochleate compositions directed against expression of proteins
  • Cochleate compositions directed against expression of proteins

Examples

Experimental program
Comparison scheme
Effect test

example 1

Preparation of Morpholino Cochleates

[0291] Rhodamine-labeled phosphatidyl ethanolamine (Rho-PE) liposomes were prepared by adding dioleoylphosphatidylserine (DOPS) and Rho-PE at a ratio of 20:1 (Rho-PE:DOPS) to chloroform at a ratio of 10 mg lipid / ml in a 50 ml sterile tube. The concentration of Rho-PE was approximately 0.1% or 0.01% with respect to the DOPS.

[0292] The sample was blown down under nitrogen to form a film. Once dry, the sample was resuspended with TES buffer at a ratio of 10 mg lipid / ml. The liposomes were then passed through a 0.22 μm filter. The homogenous population of rhodamine-labeled liposomes were stored at 4° C. in the absence of light under nitrogen.

[0293] Morpholinos were obtained from GeneTools, LLC (Philomath, OR) for the GAPDH antisense sequence 5′ATCCGTTGACACCGACCTTCACCAT3′ (SEQ ID NO.: 1), and GAPDH mismatch sequence 5′ATCCCTTGAGACCGAGCTTCTCCAT3′ (SEQ ID NO.: 2). These sequences have been used previously to target the first 25 bases of the coding seq...

example 2

Delivery of Morpholinos Via Cochleates into Cells

[0297] Morpholino-cochleates were prepared as described in Example 1, with FITC-labeled GAPDH morpholinos. These morpholino-cochleates were administered to NGF differentiated rat P12 cells and photographed at 3 hours and 12 hours as shown in FIGS. 1A and 1B, respectively, after cochleate introduction. As illuminated by the fluoresced rhodamine using LCSM fluorescence imaging, the cochleates fuse with the outer membrane and form submembrane aggregates. FIGS. 1C (low power) and 1D (high power) are photographs of flouresced rhodamine labeled cochleates containing fluorescein isothiocyanate (FITC) labeled morpholinos. FIGS. 1C and 1D depict cochleates containing morpholinos, morpholinos that have been released into the cytosol from unwrapped cochleates, and the delivery of FITC labeled anti-GAPDH Morpholino into the cytoplasm. The morpholinos delivered into the cells depicted in these FIGS. 1A-D were retained in the cells for at least 72...

example 3

Delivery of Morpholinos Via Cochleates into Retinal Ganglion Cells

[0300] Morpholino-cochleates were prepared as described in Example 1 with FITC-labeled GAPDH morpholinos. These morpholino-cochleates were administered to retinal ganglion cells in situ in retinal organotype culture. It was observed that the morpholino-cochleates readily interacted with the cells in the retinal ganglion cell layer (FIGS. 2A and 2B). FIGS. 2A and 2B are images of X-Y RGCL LCSM computational slices demonstrating avid cochleate uptake by retinal ganglion cells in situ. Scale bars indicate 10 micrometers.

[0301]FIG. 2A indicates cochleate delivery and biological activity of the antisense molecules. Interference with GAPDH by the antisense molecule triggers apoptosis, detected here by YOYO staining of all the retinal ganglion cells in the field. Cell nuclei with apoptotic chromatin condensation have very bright homogeneous YOYO signals (See FIG. 2B). This system provides a very efficient technique for del...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Fractionaaaaaaaaaa
Fractionaaaaaaaaaa
Compositionaaaaaaaaaa
Login to View More

Abstract

Disclosed herein are novel siRNA-cochleate and morpholino-cochleate compositions. Also disclosed are methods of making and using siRNA-cochleate and morpholino-cochleate compositions.

Description

RELATED APPLICATIONS [0001] This application claims the benefit of U.S. Provisional Application No. 60 / 461,483, filed Apr. 9, 2003; U.S. Provisional Application Ser. No. 60 / 463,076, filed Apr. 15, 2003; U.S. Provisional Application Ser. No: 60 / 502,557, filed Sep. 11, 2003; U.S. Provisional Application No. 60 / 499,247 filed Aug. 28, 2003; U.S. Provisional Application No. 60 / 532,755, filed Dec. 24, 2003. The entire contents of each of the aforementioned applications are hereby expressly incorporated herein by reference in their entireties.BACKGROUND OF THE INVENTION [0002] In diverse eukaryotes, double-stranded RNA (dsRNA) triggers the destruction of mRNA sharing sequence with the double-strand (Hutvdgner et al. (2002) Curr. Opin. Genet. Dev. 12:225-232; Hannon (2002) Nature 418:244-25 1). In animals and basal eukaryotes, this process is called RNA interference (RNAi) (Fire et al. (1998) Nature 391:806-811). There is now wide agreement that RNAi is initiated by the conversion of dsRNA ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): A61K9/00A61K9/127A61K31/7048A61K38/00A61K47/48C12N15/11C12N15/113
CPCC12N2310/14C12N2310/3233C12N2310/53C12N2320/32C12Y102/01012A61K9/1274A61K9/127A61K38/00C12N15/111C12N15/113C12N15/1135C12N15/1137A61K31/7048A61K31/7088C07H21/02C07H21/04A61K47/6919A61P1/04A61P1/16A61P1/18A61P11/00A61P11/02A61P11/06A61P13/08A61P13/12A61P15/00A61P15/08A61P17/00A61P17/06A61P19/00A61P19/02A61P21/00A61P21/04A61P25/00A61P25/02A61P25/16A61P25/18A61P25/24A61P25/28A61P27/02A61P29/00A61P3/00A61P3/04A61P31/00A61P31/04A61P31/10A61P31/12A61P35/00A61P35/02A61P3/06A61P37/00A61P37/02A61P37/06A61P43/00A61P7/00A61P7/02A61P7/04A61P7/06A61P9/00A61P9/10A61P3/10
InventorGOULD-FOGERITE, SUSANMANNINO, RAPHAELAHL, PATRICKSHANG, GAOFENGCHEN, ZIKRAUSE-ELSMORE, SARA
OwnerBIODELIVERY SCI