Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Connective Tissue Growth Factor-2

a technology of connective tissue and growth factor, which is applied in the direction of peptides, drug compositions, fused cells, etc., can solve the problems of uncontrolled growth of cells that lose the ability to respond to tgf-, and become tumorigenic, so as to promote attachment, fixation and stabilization of tissue implants, and enhance wound healing

Inactive Publication Date: 2010-02-18
HUMAN GENOME SCI INC
View PDF13 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

This patent is about a new polypeptide called connective tissue growth factor-2 (CTGF-2) and its use in treating diseases and promoting tissue regeneration. The patent describes the structure and function of CTGF-2, as well as its production and use. It also describes the use of antibodies and agonists / antagonists to control the action of CTGF-2. The patent also mentions the potential for diagnostic assays and in vitro research uses of CTGF-2. Overall, the patent provides a technical solution for utilizing CTGF-2 for therapeutic purposes.

Problems solved by technology

Accordingly, cells that lose the ability to respond to TGF-β are more likely to exhibit uncontrolled growth and become tumorigenic.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Connective Tissue Growth Factor-2
  • Connective Tissue Growth Factor-2
  • Connective Tissue Growth Factor-2

Examples

Experimental program
Comparison scheme
Effect test

example 1

Cloning and Expression of CTGF-2 in a Baculovirus Expression System

[0117]The DNA sequence encoding the full length CTGF-2 protein, ATCC® # 75804, was amplified using PCR oligonucleotide primers corresponding to the 5′ and 3′ sequences of the gene:

[0118]The 5′ primer has the sequence CGCGGGATCCTGCGCGACACAATGAGCT (SEQ ID NO:3) and contains a BamHI restriction enzyme site (in bold) followed by 18 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol. Biol. 1987, 196, 947-950, Kozak, M.). The initiation codon for translation “ATG” is underlined.

[0119]The 3′ primer has the sequence CGCGGGTACCAGGTAGCATTTAGTCCCTAA (SEQ ID NO:4) and contains the cleavage site for the restriction endonuclease Asp781 and 20 nucleotides complementary to the 3′ non-translated sequence of the CTGF-2 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit (GENECLEAN®, BIO 101 Inc., La Jolla, Calif.). The fragment was t...

example 2

Expression of Recombinant CTGF-2 in COS Cells

[0129]The expression of plasmid, CTGF-2 HA is derived from a vector pcDNAI / Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire CTGF-2 precursor and a HA tag fused in frame to its 3′ end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to our target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

[0130]The plasmid construction strategy is described as follows:

[0131]The DNA sequence en...

example 3

Expression via Gene Therapy

[0132]Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37° C. for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.

[0133]pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988)) flanked by the long terminal repeats of the M...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to a human CTGF-2 polypeptide and DNA (RNA) encoding such polypeptide. Also provided is a procedure for producing such polypeptide by recombinant techniques and antibodies and antagonist / inhibitors against such polypeptide. Also provided are methods of using the polypeptide therapeutically for enhancing the repair of connective and support tissue, promoting the attachment, fixation and stabilization of tissue implants and enhancing wound healing. Diagnostic assays for identifying mutations in nucleic acid sequence encoding a polypeptide of the present invention and for detecting altered levels of the polypeptide of the present invention are also disclosed.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS[0001]This application is a continuation of U.S. patent application Ser. No. 11 / 563,870, filed Nov. 28, 2006, which is a continuation of U.S. patent application Ser. No. 10 / 294,796, filed Nov. 15, 2002, now abandoned, which is a divisional of U.S. patent application Ser. No. 09 / 348,815, filed Jul. 8, 1999, now U.S. Pat. No. 6,534,630, granted Mar. 18, 2003, which is a divisional of U.S. patent application Ser. No. 08 / 459,101, filed Jun. 2, 1995, now U.S. Pat. No. 5,945,300, granted Aug. 31, 1999, which is a continuation-in-part of International Patent Application No. PCT / US94 / 07736, filed Jul. 12, 1994; each of which is hereby incorporated by reference in their entireties.REFERENCE TO SEQUENCE LISTING AS TEXT FILE[0002]This application refers to a “Sequence Listing” listed below, which is provided as a text file. The text file contains a document entitled “PF126PID2C2_SequenceListing.txt” (10,425 bytes, created Sep. 24, 2009), which is incorpor...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(United States)
IPC IPC(8): C12N5/10C07K16/22A61K8/00C12N15/09A61K8/64A61K8/99A61K38/00A61K38/18A61K38/27A61K48/00A61P17/00A61P35/00A61P43/00A61Q19/00C07K14/475C12N5/00C12N15/12C12N15/18C12P21/02C12R1/91
CPCA61K38/00A61K48/00C07K2319/00C07K14/475A61K2039/505A61P17/00A61P35/00A61P43/00
Inventor LI, HAODONGADAMS, MARK D.
Owner HUMAN GENOME SCI INC
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com