Anti-obesity agent and Anti-obesity food
an anti-obesity food and agent technology, applied in the direction of peptides, drug compositions, metabolic disorders, etc., can solve the problems of adverse effects on the body, difficulty in exercising, and increase in the number of obese persons, so as to prevent obesity spontaneously and inhibit obesity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Benefits of technology
Problems solved by technology
Method used
Image
Examples
example 1
Anti-obesity Effect Test of L. reuteri JCM1112T
[0050]An anti-obesity effect of L. reuteri JCM1112T was examined by the following materials and method.
Materials and Test Method:
(1) Experimental Animal:
[0051]Wistar rats of SPF grade (males of 8-week-old; Japan SLC, Inc.) having a body weight of from about 180 to 200 g were used, an acclimatization period of 7 days from the day for the sending in a laboratory was provided, and the experiment was then started. The breeding circumstance was set up at a temperature of 22±1° C., a humidity of 55±5% and a lighting time of 12 hours (from 8:00 to 20:00); and the rats were caged individually and provided with free access to sterile distilled water through a watering bottle and a radiation-sterilized solid diet* for rat (CE-2, CLEA Japan, Inc.) by a feeder, respectively. All of the breeding instruments to be used were ones sterilized by a high-pressure steam sterilizer.
[0052]*: Use for breeding and propagation (crude fat: 4.6%)
(2) Preparation o...
example 2
Genome Analysis of L. reuteri JCM1112T
[0058]DNA was obtained from L. reuteri JCM1112T by using the following chemicals in the following method, thereby achieving genome analysis.
Method for Obtaining DNA:
(Chemicals)
[0059]Nuclei Lysis solution (Wizard genome DNA purification kit; manufactured by Promega)[0060]Physiological saline[0061]50 mM EDTA (pH: 7.0)[0062]50 mg / mL lysozyme solution (prepared on the day by dissolving a prescribed amount of lysozyme in a TE buffer solution, 0.25 M Tris-HCl (pH 8.0) or 10 mM Tris-HCl (pH 8.0) / 10 mM EDTA / 0.5% SDS)[0063]2 mg / mL EDTA[0064]Phenol / chloroform / isoamyl alcohol (25:24:1) mixed solution (hereinafter abbreviated as “PCI”)[0065]Chloroform / isoamyl alcohol (24:1) mixed solution (hereinafter abbreviated as “CIA”)[0066]99% Ethanol[0067]70% Ethanol[0068]TE buffer solution
(Method)
[0069]1. L. reuteri JCM1112T is cultured at 37° C. for 24 hours under static conditions, and the obtained culture solution (50 mL) is centrifuged at 3,500 r.p.m. for 15 minu...
example 3
Amplification of Glycerol-degrading Gene
[0074]PCR was carried out by using DNA as purified in Example 2 as a template and the following nucleotide sequences as primers and using the following reaction solutions. The PCR condition is also shown below.
(Primer)pduCDE(F):CACCATGAAACGTCAAAAACGATTTpduCDE(R):AAAAGCTTAGTTATCGCCCTTTAGC
(PCR reaction solution)Template DNA: 1 μLKOD-plus: 1 μL10 × KOD-plus buffer solution: 5 μLdNTP (2 mM each): 5 μLPrimer (20 mm): 1 μL eachMgSO4 (25 mm): 2 μLDeionized water (D.W.):34 μL
(PCR Condition)
[0075](1) To hold at 94° C. for 3 minutes.
(2) To hold at 94° C. for 15 seconds.
(3) To hold at 56° C. (Tm) for 30 seconds.
(4) To hold at 68° C. for 3 minutes 30 seconds.
(5) To perform (2) to (4) in 30 cycles.
(6) To preserve at 4° C.
PUM
| Property | Measurement | Unit |
|---|---|---|
| temperature | aaaaa | aaaaa |
| pH | aaaaa | aaaaa |
| body weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com


