Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof
A rapid diagnosis technology for Staphylococcus aureus, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of no genetic rapid diagnostic kits for the detection of Staphylococcus aureus, and achieve significant color difference, The effect of high yield and low detection cost
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0034] The preparation of embodiment 1 kit
[0035] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:
[0036] Outer primer F3: TTTTCATAATCRATCACTGGAC, as shown in SEQ ID NO: 1;
[0037] Outer primer B3: TTTAACAGCTAAAGAGTTTGGT, as shown in SEQ ID NO: 2;
[0038]Internal primer FIP: ACAATAATAACGAGGTYATTGCAGCTTTTCTTGAACACTTTCATAACAGGTAC, as shown in SEQ ID NO: 3;
[0039] Internal primer BIP: CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC, as shown in SEQ ID NO: 4;
[0040] (2) Purchase DNA polymerase: Bst DNA polymerase (Large Fragment). Put in container.
[0041] (3) Preparation of reaction solution: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L potassium chloride, 12.5mmol / L ammonium sulfate, 10mmol / L magnesium sulfate, 0.125% TritonX-100, 1mol / L betaine, 2 mol / L each of the inner primers FIP / BIP and 0.25 mol / L each of the outer primers F3 / B3 were placed in the container.
[0042] (4) Pr...
Embodiment 2
[0053] The preparation of embodiment 2 kit
[0054] The formula of the reaction solution is: the reaction solution contains 1.8mmol / L dNTP, 20mmol / L Tris-HCl, 10mmol / L potassium chloride, 10mmol / L ammonium sulfate, 8mmol / L magnesium sulfate, 0.1%TritonX-100, 0.8mol / L betaine, each 1.6mol / L of inner primer FIP / BIP and each 0.2mol / L of outer primer F3 / B3;
[0055] The formula of the sample pretreatment solution is as follows: the sample pretreatment solution contains 10 mmol / L Tris-HCl with pH 8.0, 1 mmol / L EDTA and 1% Triton X-100.
[0056] Others are the same as embodiment 1.
Embodiment 3
[0057] Example 3 Application of Staphylococcus aureus Gene Rapid Diagnostic Kit
[0058] 1. Sample processing (template DNA extraction)
[0059] 1) Take 1mμl of the overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000rpm for 2 minutes, and remove the supernatant;
[0060] 2) Add 100 μl of sample pretreatment solution to the centrifuge tube, and mix evenly with the precipitated cells;
[0061] 3) After cooking in boiling water for 10 minutes, immediately place it on ice to cool for 10 minutes;
[0062] 4) Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.
[0063] 2. The reaction process of loop-mediated isothermal amplification technology
[0064] 1) Prepare a reaction system in a 200 μl reaction tube: 22 μl of reaction solution, 0.5 μl of Bst DNA polymerase (4U), and 2.5 μl of template DNA.
[0065] 2) React the prepared reaction tube at a constant temperature of 64° C. for 1 h.
[0066] 3. Post-r...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com