Unlock instant, AI-driven research and patent intelligence for your innovation.

Rapid diagnosis kit for staphylococcus aureus gene based on loop-mediated isothermal amplification technology and detecting method thereof

A rapid diagnosis technology for Staphylococcus aureus, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, etc., can solve the problems of no genetic rapid diagnostic kits for the detection of Staphylococcus aureus, and achieve significant color difference, The effect of high yield and low detection cost

Inactive Publication Date: 2008-11-19
GUANGZHOU HUAFENG BIOTECH
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, isothermal amplification (Isothermal Amplification) nucleic acid rapid detection technology is a great progress in pathogenic nucleic acid detection technology. The established loop-mediated isothermal amplification technology (loop-mediated isothermal amplification of DNA, LAMP) has many advantages. and there is currently no gene rapid diagnostic kit for the detection of Staphylococcus aureus using loop-mediated isothermal amplification technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] The preparation of embodiment 1 kit

[0035] (1) Synthesize oligodeoxynucleic acid primers by DNA synthesizer according to the following sequence:

[0036] Outer primer F3: TTTTCATAATCRATCACTGGAC, as shown in SEQ ID NO: 1;

[0037] Outer primer B3: TTTAACAGCTAAAGAGTTTGGT, as shown in SEQ ID NO: 2;

[0038]Internal primer FIP: ACAATAATAACGAGGTYATTGCAGCTTTTCTTGAACACTTTCATAACAGGTAC, as shown in SEQ ID NO: 3;

[0039] Internal primer BIP: CCTTCAGCAAGCTTTAACTCATAGTTTTTCAGATAGCATGCCATACAGTC, as shown in SEQ ID NO: 4;

[0040] (2) Purchase DNA polymerase: Bst DNA polymerase (Large Fragment). Put in container.

[0041] (3) Preparation of reaction solution: the reaction solution contains 2mmol / LdNTP, 25mmol / L Tris-Cl, 12.5mmol / L potassium chloride, 12.5mmol / L ammonium sulfate, 10mmol / L magnesium sulfate, 0.125% TritonX-100, 1mol / L betaine, 2 mol / L each of the inner primers FIP / BIP and 0.25 mol / L each of the outer primers F3 / B3 were placed in the container.

[0042] (4) Pr...

Embodiment 2

[0053] The preparation of embodiment 2 kit

[0054] The formula of the reaction solution is: the reaction solution contains 1.8mmol / L dNTP, 20mmol / L Tris-HCl, 10mmol / L potassium chloride, 10mmol / L ammonium sulfate, 8mmol / L magnesium sulfate, 0.1%TritonX-100, 0.8mol / L betaine, each 1.6mol / L of inner primer FIP / BIP and each 0.2mol / L of outer primer F3 / B3;

[0055] The formula of the sample pretreatment solution is as follows: the sample pretreatment solution contains 10 mmol / L Tris-HCl with pH 8.0, 1 mmol / L EDTA and 1% Triton X-100.

[0056] Others are the same as embodiment 1.

Embodiment 3

[0057] Example 3 Application of Staphylococcus aureus Gene Rapid Diagnostic Kit

[0058] 1. Sample processing (template DNA extraction)

[0059] 1) Take 1mμl of the overnight culture enrichment solution in an eppendorf tube, centrifuge at 1000rpm for 2 minutes, and remove the supernatant;

[0060] 2) Add 100 μl of sample pretreatment solution to the centrifuge tube, and mix evenly with the precipitated cells;

[0061] 3) After cooking in boiling water for 10 minutes, immediately place it on ice to cool for 10 minutes;

[0062] 4) Centrifuge at 10,000 rpm for 2 minutes, and the supernatant can be used as template DNA to be used.

[0063] 2. The reaction process of loop-mediated isothermal amplification technology

[0064] 1) Prepare a reaction system in a 200 μl reaction tube: 22 μl of reaction solution, 0.5 μl of Bst DNA polymerase (4U), and 2.5 μl of template DNA.

[0065] 2) React the prepared reaction tube at a constant temperature of 64° C. for 1 h.

[0066] 3. Post-r...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a golden yellow staphylococcus gene quick diagnosis reagent box and a method for detecting the same. The reagent box consists of two pairs of primers, DNA polymerase, reaction liquid, sample pretreatment liquid, developing liquid and a positive contrast solution, and the six kinds of liquid are respectively contained in a container. The gene quick diagnosis reagent box adopts six segments and four primers, and can judge whether a target substance exists or not according to the fact whether amplification occurs or not, thereby having high specificity. Moreover, the reagent box has quickness, high efficiency and high sensitivity, and can carry out amplification reaction just at a constant temperature without adopting special reagent and equipment, thereby ensuring low detection cost. In addition, the reagent box can realize simple identification; therefore, pyrophosphate radical ion separated out from dNTP is combined with Mg<2+> in a reaction solution so as to generate byproduct magnesium pyrophosphate precipitate which can be identified through unaided viewing; moreover, after the developing liquid is added, the remarkable positive and negative result color developing difference is more obvious and reliable.

Description

technical field [0001] The invention relates to a biological detection reagent, in particular to a rapid diagnosis kit for Staphylococcus aureus gene and a detection method thereof. Background technique [0002] At present, there are a variety of detection methods for Staphylococcus aureus, ranging from national standards (GB / T4789. Nucleic acid probes, polymerase chain reaction (PCR) technology and other molecular biological detection methods [Food Safety Testing and Modern Biotechnology, Chemical Industry Press, 2004]. Among them, the detection of pathogenic nucleic acids has greatly improved in terms of rapidity, safety, accuracy and sensitivity. These new technologies try to break through the traditional microbiological detection modes such as morphology and biochemical reactions, and do not need to separate microorganisms. Purification, and directly use the sample or sample enrichment solution to quickly detect its gene and gene product, and combine with molecular biol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/14C12Q1/68
Inventor 石磊曹以诚陈洵杜正平谭慧媚刘妙琴赵长臣李心晖
Owner GUANGZHOU HUAFENG BIOTECH