Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene chip for detecting bacterial infection for flocks and herds, preparing and detecting process and kit

A technology of gene chips and bacteria, applied in the field of biological detection, can solve the problems of false positives, cross-contamination, time-consuming, etc.

Inactive Publication Date: 2008-12-31
IPE BIOTECHNOLOGY CO LTD
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Conventional technologies include microbial culture technology, immune technology, PCR technology, etc. Although these detection technologies have played a huge role, there are still the following defects: microbial culture technology is cumbersome and time-consuming; immune technology requires specific antiserum; PCR The superiority of the technology itself is understandable, but improper control of reaction conditions can easily cause cross-contamination and false positives
The existence of these defects makes conventional detection methods unable to meet the requirements of fast, accurate and high-throughput detection of animal diseases, and the development of new detection methods for animal diseases is imminent

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip for detecting bacterial infection for flocks and herds, preparing and detecting process and kit
  • Gene chip for detecting bacterial infection for flocks and herds, preparing and detecting process and kit
  • Gene chip for detecting bacterial infection for flocks and herds, preparing and detecting process and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0137] Design and synthesis of detection probes for Brucella abortus DEFINITION Brucella abortus strain 544 uracilpermease homolog(bme16) and Bme11(bme11) genes, partial cds.

[0138] 1. Design

[0139] The detection probe of the bacterial pathogen was obtained through literature search and comparison of the National Center for Biological Information (NCBI) of the United States. In the first step, the target gene of the pathogen was determined based on a large amount of previous literature research. After Genbank search, BLAST sequence alignment obtained a relatively conserved region (target sequence);

[0140] In the second step, according to the principle of probe design, use Primer Premier5.0 and Oligo6.0 software to design detection probes for pathogens in this conserved region;

[0141] After obtaining the sequence of the detection probe, a specialized biological company will synthesize the corresponding probe fragment. The corresponding nucleic acid sequence is as fol...

Embodiment 2

[0151] Goat Brucella (Brucella.Melitensis) DEFINITION Brucella melitensis insertionsequence IS711, partial sequence. The design and synthetic method of detection probe are the same as embodiment 1, the relatively conserved region (target sequence) of the Goat Brucella genome nucleic acid sequence that chooses for:

[0152] Fragment 2 (SEQ ID NO: 2)

[0153]TCGGCTCAGAATAATCCACAGAAGGTAGAGCAGTAATATCCAATAGACGCCATTAACAATAGCGAGATTGGAATAGCTTCCCGCCAATCTTCGCCCTGCCACCAGCCAATAACGGCAATTATCGCTGTCACTGTTGCAAGTATGGCAGCGAGCGCTCTAGCGTGACGAAGCACTGTGTTTCTGACAATTTCCAGATTCACCCCTAGGGCGTGTCTGCATTCAACGTAACCAGATCATAGCGCATGCGAGATGGACGAAGCCCATGAATGCGGTCAATGTTTTCTCGCATCG

[0154] The detection probe is: ACCCGCCAATCTTCGCCCTGCCACCAGCCAATAACGGCAATTATCGCT (SEQ ID NO: 7).

Embodiment 3

[0156] Ovis Brucella (Brucella.Ovis) DEFINITION Brucella melitensis biovar Ovis63 / 290 site of large deletion involving omp25b and wboA. The design and synthetic method of detection probe are the same as embodiment 1, the selected Brucella melitensis genome nucleic acid sequence The relatively conserved region (target sequence) is:

[0157] Fragment 3 (SEQ ID NO: 3)

[0158] TTAAGAGTGGAGCGGGTAGCGGGAATCGAACCCGCGCGTTCAGCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCACCGCATAAGCGCTTCGCACTTTTGCTGGTAAA

[0159] Detection probe designed according to Fragment 3: GCTTGGGAAGCTGACAGGCTACCATTACATCATACCCGCACCGCATA (SEQ ID NO: 8).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention relates to a gene chip for detecting infectious bacterium pathogens in cattle and sheep, wherein, the gene chip comprises a solid phase carrier and an oligonucleotide probe fixed on the carrier, the oligonucleotide probe includes a detection probe and a quality control probe, and the detection probe selects DNA fragmentsfrom nucleotide sequences of cattle Brucella bacilli, goat Brucella bacilli, sheep Brucella bacilli, Mycobacterium tuberculosis var bovis and Bacillus tuberculosis typus humanus genomes. The invention also relates to a process for preparing the chip and a method utilizing the chip to detect five infectious bacterium pathogens in cattle and sheep, comprising processes of: combining the probes, preparing the chip, and carrying out the hybridization with treated and marked samples under test. The invention further relates to a detection kit of cattle and sheep infectious bacterium pathogens composed of the chip and a sample processing reagent, a hybridization reagent and a color-producing reagent as well as a specification. Utilizing the gene chip of the invention can achieve the purpose of detecting five bacteria simultaneously, and the gene chip has advantages of convenient operation, high accuracy and strong repeatability, and is significant for laboratory investigations and productive practices.

Description

technical field [0001] The invention relates to the technical field of biological detection, in particular to a gene chip for detecting bacterial pathogens infected with cattle and sheep, a preparation method for the chip, a detection method and a detection kit. Background technique [0002] Bovine brucellosis, sheep brucellosis, goat brucellosis, bovine tuberculosis, and human tuberculosis are animal infectious diseases and zoonotic diseases that animal quarantine departments around the world focus on preventing. my country's Quality Supervision, Inspection and Quarantine Bureau also lists them as cattle Goat is a necessary quarantine disease for entry-exit inspection and quarantine of animals. With the increasing international trade of large animals and related products, corresponding pathogenic microorganism detection technology has emerged as the times require. Conventional technologies include microbial culture technology, immune technology, PCR technology, etc. Althoug...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/04C12Q1/68C12M1/00
Inventor 周骋姚志建逄建涛姜存
Owner IPE BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com