Test paper strip for detecting encephalitis virus IgM antibody colloidal gold, method for making same and applications
A JE virus and detection test strip technology, applied in the field of JE virus IgM antibody colloidal gold detection test strips, can solve the problems of unsuitable clinical diagnosis routine use, complicated operation, time-consuming and other problems, to save manpower and material resources, and to achieve clear results Easy-to-distinguish, easy-to-operate effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] The preparation of embodiment 1 Japanese encephalitis virus E gene antigen domain III
[0035] (1) Obtaining the target gene
[0036] According to the sequence of the target gene fragment and the characteristics of the pGEX-4T-1 expression vector, design primers containing restriction enzymes BamH1 and HindIII restriction sites at both ends:
[0037] 5'TAAGGATCCCACCTGAAATGTAGGCTG 3'
[0038] 5'CGGGAAGCTTGAAGACCCCTCCAATAGA 3'
[0039] The total viral RNA was extracted by conventional methods, and then RT-PCR was performed immediately, and the reverse transcription product was identified and recovered by 1% agarose gel electrophoresis.
[0040] (2) Cloning of the target gene and screening of positive recombinants
[0041] Ligate the recovered PCR amplification product with the PMD-18T cloning carrier overnight at 16°C, transform into DH5a competent cells, pick a monoclonal strain, culture overnight at 37°C, extract the plasmid, and use the plasmid as a template to carr...
Embodiment 2
[0050] Example 2 Japanese encephalitis virus IgM antibody colloidal gold rapid detection test strip (see Figure 1)
[0051] (1) Preparation of colloidal gold-antibody conjugates:
[0052] It has been determined by experiments that the optimal binding pH of the colloidal label of anti-human IgM monoclonal antibody is 8.0, and the ratio of colloidal gold and antibody is 18 μg / ml colloidal gold. After the labeled colloidal gold is treated with a stabilizer (containing 0.5% BSA, pH 8.0, 0.01MTris buffer), take the colloidal gold-antibody conjugate solution in an amount of 65 μl per square centimeter, evenly adsorb on the glass fiber, and freeze-dry , and stored in a dry environment.
[0053] (2) Coating antigen on nitrocellulose membrane:
[0054] The Japanese encephalitis virus E gene antigenic domain III protein was diluted to 3.2±0.1mg / ml with 0.01MPBS. The anti-mouse IgG polyclonal antibody was diluted to 2±0.1 mg / ml with 0.01 MPBS. Spray the two on the nitrocellulose memb...
Embodiment 3
[0061] Embodiment 3 detection method (see figure 2 )
[0062] 100-150 μl of the patient's whole blood, plasma or serum specimen is directly dropped into the "4" of the test strip of Example 2, the sample solution runs up the membrane, and the result is interpreted within 10-15 minutes.
[0063] result:
[0064] If the test sample contains JE virus IgM antibody, it will form a corresponding complex with the colloidal gold-labeled anti-human IgM monoclonal antibody on the test strip, and bind to the JE virus-specific antigen coated on the nitrocellulose membrane in the upstream direction. , forming a red line, that is, a red band at T.
[0065] Regardless of whether the specimen contains the corresponding antibody or not, the colloidal gold-labeled anti-human IgM monoclonal antibody continues to crawl upward and forms a red precipitation line with the anti-mouse IgG coated on the membrane, that is, a red band is formed at "C". This line is a quality control line. If the coll...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com