Method for constructing ester bond enzyme engineering bacteria for tendency hydrolysis of TAG sn-2 and corresponding recombinant lipase

A technology of engineering bacteria and ester bond enzymes, applied in the directions of hydrolase, genetic engineering, recombinant DNA technology, etc., can solve the problems of limited industrial application and low yield, and achieve the effects of low production cost and simple induction process.

Inactive Publication Date: 2009-04-15
ZHEJIANG UNIV
View PDF8 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the very low yield of CAL-A in its original strain, the industrial application of this method is greatly limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for constructing ester bond enzyme engineering bacteria for tendency hydrolysis of TAG sn-2 and corresponding recombinant lipase
  • Method for constructing ester bond enzyme engineering bacteria for tendency hydrolysis of TAG sn-2 and corresponding recombinant lipase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Embodiment 1, a method for constructing engineering bacteria with a tendency to hydrolyze the TAG sn-2 position ester bond enzyme, the following steps are carried out in sequence:

[0050] 1), the cloning of CAL-A gene

[0051] EcoR I and Not I on pPPIC9K were selected as restriction enzyme sites, and a pair of specific primers were designed.

[0052] Upstream primer (LPU): AATAAGGAATTCGCGGCGCTGCCCAACCCCTACGAC

[0053] Downstream primer (LPD): AAGGAAAAAAGCGGCCGCCATCGACCGTGGGAACTG

[0054] The Candida antarctica genome was used as a template for PCR amplification. The PCR system is as follows: Buffer (no Mg 2+ )5μL, Mg 2+ Solution 5 μL, dNTP solution 4 μL, upstream primer 1 μL, downstream primer 1 μL, template 1 μL, Taq enzyme 0.5 μL, add water to make up 50 μL. The amplification conditions were as follows: 95°C for 5 minutes; 30 cycles of 94°C for 1 minute, 65°C for 1 minute, and 72°C for 1 minute; and 72°C for 10 minutes. After amplification, the kit (TaKaRa DNA ...

Embodiment 2

[0066] Embodiment 2, a kind of method utilizing the engineering bacterium obtained in embodiment 1 to prepare recombinant lipase adopts the induced expression of yeast, and concrete steps are as follows:

[0067] The positive transformants obtained in Example 1 were inoculated into BMGY medium, and cultured overnight at 30°C until OD 600 2 to 6, and then centrifuged to collect the bacteria. Dilute the obtained bacteria with BMMY medium to OD 600 1, adding 0.5% of the total volume of methanol every 12h to induce expression. Take 1.5ml of the culture solution for centrifugation every 24 hours, and the supernatant is the crude enzyme solution of the recombinant lipase. Induction continued until cessation on day 5.

Embodiment 3

[0068] Embodiment 3, adopt sodium hydroxide titration method to measure lipase activity

[0069] Preparation of polyvinyl alcohol olive oil emulsion: Add 4 g of polyvinyl alcohol into 100 mL of ultrapure water, heat and dissolve in microwave to form a polyvinyl alcohol solution. Then mix the polyvinyl alcohol solution and olive oil at a ratio of 4:1 (w:w), and stir 3 times with a high-speed tissue homogenizer, each time for 1 minute, with an interval of 3 minutes; to obtain a polyvinyl alcohol olive oil emulsion.

[0070] The lipase activity assay procedure is as follows: add 0.025mol / L, pH 7.5 phosphate buffer 5mL and polyvinyl alcohol olive oil emulsion 4mL in Erlenmeyer flask, bathe in water at 40°C for 5min. Then add 1 mL of the crude enzyme solution obtained in Example 2, react for 15 min, add 15 mL of 95% ethanol to terminate the reaction, and then add 3 drops of phenolphthalein indicator. Titrate with 0.05mol / L sodium hydroxide until the solution turns pink, and subtra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a building method of enzyme engineering bacteria which inclines to a hydrated TAG sn-2 bit ester bond and includes the following steps of: 1) the cloning of a CAL-A gene; 2) the building of a recombinant vector: double enzyme digestion and connection are carried out on a PCR product and the vector by utilizing a restriction enzyme for building the recombinant vector; converting the recombinant vector into colon bacillus and screening a positive recombinant vector through PCR authentication; and 3) converting: carrying out linearization on the positive recombinant vector by adopting the restriction enzyme and electrically transferring the positive recombinant vector into a host strain, and then screening the positive engineering bacteria by adopting PCR authentication. The invention simultaneously provides a method for preparing a recombinant lipase by utilizing the engineering bacteria obtained through the method. The recombinant lipase can be used for hydrolyzing triglyceride edible oil.

Description

technical field [0001] The invention relates to a lipase engineering bacterium with a tendency to hydrolyze the sn-2 ester bond of triglyceride and a construction method of the corresponding recombinant lipase. Background technique [0002] With the improvement of the world's economic level, the intake of animal food has increased, which has led to a substantial increase in the intake of dietary fat. The survey report of the Chinese Center for Disease Control and Prevention (CDC) shows that in 2002, the daily oil intake of Chinese residents was about 44g, and the contained energy accounted for 35% of the total dietary energy, which was higher than the 30% upper limit recommended by the World Health Organization. Excessive fat intake can lead to diseases such as obesity, high blood pressure, diabetes, and atherosclerosis. The treatment of these diseases and their complications not only brings a heavy economic burden to the patient's family, but also brings a heavy social bur...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/55C12N15/81C12N1/19C12N9/20C12R1/84
Inventor李铎徐同成张治国
OwnerZHEJIANG UNIV