Method for improving saponin content of ginseng germplasm

A technology of ginsenoside and ginseng, which is applied in the field of cultivating ginseng germplasm resources with high saponin content, can solve the problems of enzyme activity reduction, and achieve the effect of shortening the breeding cycle

Inactive Publication Date: 2009-06-24
JILIN UNIV
0 Cites 12 Cited by

AI-Extracted Technical Summary

Problems solved by technology

[0003] The method of using antisense RNA technology to express antisense RNA fragments that match the target mRNA in cells to inhibit the translation of mRNA and reduce the activity of enzymes cont...
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Abstract

The invention relates to a method of increasing ginseng germ plasm saponin content, belonging to the biotechnology field. The steps of the method are as follows: 1. the plant expression vector pBI-ACAS of reversal cycloartenol synthetase CAS gene is constructed; 2. agrobacterium rhizogene A4-ACAS with an objective vector is obtained by the conversion of a bacterial strain of the agrobacterium rhizogene A4 by pBI-ACAS; 3. a ginseng hairy root clone for expressing the reversal CAS gene is produced by mediating a ginseng root explant with the agrobacterium rhizogene A4; a test-tube plant is obtained through the body cell embryogenesis with the ginseng hairy root clone that has high ginseng saponin content and expresses the reversal CAS gene as a culture material. In the invention, the ginseng hairy root clone that has high ginseng saponin content and new genetic resources of ginseng test-tube plants are constructed, different applications can be realized; through large-scale liquid culture of the hairy root clone, high-yield ginseng saponin can be obtained directly. If a new ginseng line with high ginseng saponin content is cultured by regeneration plant, the new ginseng line can be used in the cultivate production, and can obviously shorten the breeding cycle of a ginseng.

Application Domain

Technology Topic

Root systemGinsenoside +15

Image

  • Method for improving saponin content of ginseng germplasm
  • Method for improving saponin content of ginseng germplasm
  • Method for improving saponin content of ginseng germplasm

Examples

  • Experimental program(1)
  • Effect test(1)

Example Embodiment

[0020] The present invention adopts the improved CTAB method to extract the total RNA of ginseng genome, and concrete improvement is as follows: (1) reduce the initial amount of sample, make it and the ratio of extraction buffer solution be about 1: 15; (2) beta mercaptoethanol concentration improves to 0.3 mol/L; (3) 3 mol/L NaAc equal to the volume of isopropanol was added when RNA was precipitated with isopropanol at -20°C. The extracted total RNA was detected by 1% agarose gel electrophoresis. As a result, there were 3 relatively obvious swimming bands in each sample, corresponding to 28S, 18S and 5S RNA respectively, and the ratio of 28S/18S was 2:1, so the extracted RNA it `s complete.
[0021] The primers for RT-PCR amplification of CAS gene were designed according to GeneBank (accession no.AB009029) Sense primer 1: 5'GAGCTCGCCTGAAGAGCTTGCGGAGGTCGAGAAAGT3' and Antisense primer 2: 5'TCTAGATTCCCAGACCTTGTCCAGTGATGCCCAAAG3' , and add SacI and XbaI restriction sites to the 5' ends of the upstream and downstream primers respectively, use Antisense for reverse transcription, and then use Sense and Antisense for PCR amplification. The PCR cycling conditions were as follows: 94°C pre-denaturation for 4 min, 94°C denaturation for 30 s, 60°C annealing for 30 s, 72°C extension for 2 min 30 s, 30 cycles, and finally extension for 10 min. The amplification result showed a very specific band slightly below 1000bp, which was the same as the expected CAS gene sequence (901bp). The PCR product was sequenced using Sense2, and the amplified result was the target gene, whose sequence was the same as that of the CAS gene The sequence is the same.
[0022] The RT-PCR product was recombined into the pMD18-T cloning vector by adding an A tail to the obtained CAS gene cDNA, then connecting the cDNA with the pMD18-T vector, and then thermally transforming the pMD-CAS competent cells of Escherichia coli JM109 with the obtained CAS gene. The recombinant CSA clone was obtained by screening and PCR identification. The transformed Escherichia coli were plated and cultured overnight to form colonies. Use a sterilized toothpick to pick white colonies to screen bacteria, and use Sense and Antisense primers for PCR amplification. Pick positive bacteria with a sterile toothpick and culture overnight in 4ml LB liquid medium, then extract the plasmid and carry out SacI-XbaI double enzyme digestion for identification.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

no PUM

Description & Claims & Application Information

We can also present the details of the Description, Claims and Application information to help users get a comprehensive understanding of the technical details of the patent, such as background art, summary of invention, brief description of drawings, description of embodiments, and other original content. On the other hand, users can also determine the specific scope of protection of the technology through the list of claims; as well as understand the changes in the life cycle of the technology with the presentation of the patent timeline. Login to view more.
the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Similar technology patents

Seedling breeding method of passiflora edulis

InactiveCN108293694APromote growth and differentiationShorten the breeding cycleBiocideAnimal corpse fertilisersFertilizerGermination
Owner:印江菌果农牧科技有限公司

Method for rapidly breeding early blooming and fruiting stock of apple

InactiveCN107568056AShorten the breeding cycleRapid result transformationGraftingPlant tissue cultureRootstockOffspring
Owner:QINGDAO ACAD OF AGRI SCI

Classification and recommendation of technical efficacy words

  • Shorten the breeding cycle

Mandarin fish artificial advance propagation method

InactiveCN1736343AEarly breeding timeShorten the breeding cycleAnimal reproductionClimate change adaptationBroodstockReproductive cycle
Owner:苏州市水产研究所有限公司

Breeding method for importing false smut resistance of indica rice into japonica rice

ActiveCN104542256AEfficient importShorten the breeding cyclePlant tissue cultureHorticulture methodsCross breedingJaponica rice
Owner:云南楚源种业有限责任公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products