Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for improving saponin content of ginseng germplasm

A technology of ginsenoside and ginseng, which is applied in the field of cultivating ginseng germplasm resources with high saponin content, can solve the problems of enzyme activity reduction, and achieve the effect of shortening the breeding cycle

Inactive Publication Date: 2009-06-24
JILIN UNIV
View PDF0 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] The method of using antisense RNA technology to express antisense RNA fragments that match the target mRNA in cells to inhibit the translation of mRNA and reduce the activity of enzymes controlled by the target gene, thereby changing the flow of biosynthetic metabolism has been successful. It is used in plant breeding and genetic improvement, but there is no relevant report on ginseng

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving saponin content of ginseng germplasm
  • Method for improving saponin content of ginseng germplasm
  • Method for improving saponin content of ginseng germplasm

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0020] The present invention adopts the improved CTAB method to extract the total RNA of ginseng genome, and concrete improvement is as follows: (1) reduce the initial amount of sample, make it and the ratio of extraction buffer solution be about 1: 15; (2) beta mercaptoethanol concentration improves to 0.3 mol / L; (3) 3 mol / L NaAc equal to the volume of isopropanol was added when RNA was precipitated with isopropanol at -20°C. The extracted total RNA was detected by 1% agarose gel electrophoresis. As a result, there were 3 relatively obvious swimming bands in each sample, corresponding to 28S, 18S and 5S RNA respectively, and the ratio of 28S / 18S was 2:1, so the extracted RNA it `s complete.

[0021] The primers for RT-PCR amplification of CAS gene were designed according to GeneBank (accession no.AB009029) Sense primer 1: 5'GAGCTCGCCTGAAGAGCTTGCGGAGGTCGAGAAAGT3' and Antisense primer 2: 5'TCTAGATTCCCAGACCTTGTCCAGTGATGCCCAAAG3' , and add SacI and XbaI restriction sites to the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method of increasing ginseng germ plasm saponin content, belonging to the biotechnology field. The steps of the method are as follows: 1. the plant expression vector pBI-ACAS of reversal cycloartenol synthetase CAS gene is constructed; 2. agrobacterium rhizogene A4-ACAS with an objective vector is obtained by the conversion of a bacterial strain of the agrobacterium rhizogene A4 by pBI-ACAS; 3. a ginseng hairy root clone for expressing the reversal CAS gene is produced by mediating a ginseng root explant with the agrobacterium rhizogene A4; a test-tube plant is obtained through the body cell embryogenesis with the ginseng hairy root clone that has high ginseng saponin content and expresses the reversal CAS gene as a culture material. In the invention, the ginseng hairy root clone that has high ginseng saponin content and new genetic resources of ginseng test-tube plants are constructed, different applications can be realized; through large-scale liquid culture of the hairy root clone, high-yield ginseng saponin can be obtained directly. If a new ginseng line with high ginseng saponin content is cultured by regeneration plant, the new ginseng line can be used in the cultivate production, and can obviously shorten the breeding cycle of a ginseng.

Description

technical field [0001] The invention relates to the field of biotechnology, specifically a method for regulating the gene activity of key enzymes in the ginsenoside synthesis pathway and cultivating ginseng germplasm resources with high saponin content by means of genetic engineering. Background technique [0002] Ginseng is a perennial plant, generally blooms normally in 4 years, harvests in 6 years, and has a low reproductive coefficient (about 3). Conventional breeding needs more than 30 years, which seriously limits the process of ginseng breeding. Genetic improvement methods for quality saponin content are available. According to the mechanism that ginsenoside is synthesized by 2,3-oxidized squalene through a series of cyclization reactions, cycloaciool synthase (CAS) controls the flow of 2,3-oxidized spinachene to the sterol synthesis pathway, and dammarene Diol synthase controls the flow of 2,3-oxyspinaene to the ginsenoside synthesis pathway. [0003] The method of...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/52A01H1/00A01H4/00
Inventor 赵寿经钱延春梁彦龙陈玉香徐立新王建华侯春喜王雪松骆晓沛张昕
Owner JILIN UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More