Fluorescent tracing multifunctional decoloring Shewanella engineered decolorationis and construction method thereof

A technology of decolorizing Shewanella and decolorizing Shewanella, which is applied in the fields of biology and environmental engineering, can solve the problems of limited application, and achieve the effects of wide decolorization range, good genetic stability, and convenient tracking and detection

Active Publication Date: 2011-05-11
GUANGDONG INST OF MICROORGANISM
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The enzyme can catalyze the decolorization and degradation of various triphenylmethane dyes such as crystal violet, basic fuchsin, brilliant green and malachite green. It has structural specificity for substrates and can efficiently decolorize and degrade triphenylmethane dye strains , but due to the potential pathogenicity of this type of bacteria to fish and frogs, the application of this strain in environmental bioremediation is limited

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescent tracing multifunctional decoloring Shewanella engineered decolorationis and construction method thereof
  • Fluorescent tracing multifunctional decoloring Shewanella engineered decolorationis and construction method thereof
  • Fluorescent tracing multifunctional decoloring Shewanella engineered decolorationis and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] (1) The total DNA of Shewanella depigmentation S12 and Aeromonas hydrophila DN322 was extracted by conventional methods.

[0036] (2) Acquisition of the NAD(P)H dehydrogenase gene promoter sequence Spr of Shewanella depigmentation S12.

[0037] According to the sequence data of Shewanella sp.ANA-3 genome, the Promoter sequence of reading frame 0316, design primers:

[0038] Upstream primer: prometerEF: 5'TTTTTCTTTTTTATGGGCTA 3';

[0039] Downstream primer: prometerER: 5'TTTAGACATAATCTGCTCCG 3';

[0040] The Promoter sequence of the NAD(P)H dehydrogenase gene was amplified by PCR using the Genomic DNA of Shewanella depigmentation S12 as a template, and named as SNDPromoter (SPr).

[0041] The PCR reaction conditions are as follows: denaturation at 95°C for 4 minutes, followed by 30 cycles: denaturation at 93°C for 30 seconds, annealing at 43°C for 30 seconds, extension at 72°C for 45 seconds, and final extension for 7 minutes. The amplified product is 98 bp. figure 1 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
molecular weightaaaaaaaaaa
Login to view more

Abstract

The invention discloses a discoloring Shiva engineering bacterium with multiple functions of fluorescent tracing and discoloring and a construction method of the discoloring Shiva engineering bacterium, and aims at providing a genetic engineering bacterium that has high-efficiency discoloring capability of three major dyes including azo, anthraquinone and triphenylmethane as well as the fluorescent tracing function. The invention adopts the technical proposal that combines a foreign fusion gene SPrtpmD' into a discoloring Shiva bacterium S12; wherein, the fusion gene SPrtpmD' is formed by connecting a discoloring enzyme modifier gene tpmD' of the triphenylmethane dye after a NAD(P)H dehydrogenase gene initiator sequence of the discoloring Shiva bacterium S12, and the discoloring enzyme modifier gene tpmD' of the triphenylmethane dye is formed by adding an SD sequence before a 5'-end initiation codon of the discoloring enzyme modifier gene tpmD' of the triphenylmethane dye and adding asmall label that can chelate 6 encoding amino acids of a diarsenic fluorescent dye before a 3'-end termination codon. The discoloring Shiva engineering bacterium with multiple functions of fluorescent tracing and discoloring can be used for environmental reparation and administration.

Description

Technical field: [0001] The invention belongs to the fields of biotechnology and environmental engineering, and in particular relates to a fluorescent tracer multifunctional decolorizing decolorizing Shewanella engineering bacterium and a construction method thereof. Background technique: [0002] The pollution of dyes and dye wastewater to the environment and the harm to human beings have been widely concerned by the world, and have become a global ecological environment problem. The control and elimination of this pollution has attracted great attention of scholars from all over the world. Practice has proved that the anaerobic-aerobic biological enhancement treatment system is the most economical and effective technology. The ways to achieve bioaugmentation technology include: ① Adding effective degradable microorganisms; ② Optimizing the nutrient supply of the existing treatment system; ③ Adding genetically engineered bacteria. [0003] At present, the most common meth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/21C12N15/62C12Q1/68C12Q1/04G01N21/64C12R1/01
Inventor 孙国萍卫晋波任随周许玫英
Owner GUANGDONG INST OF MICROORGANISM
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products