Fluorescent tracing multifunctional decoloring Shewanella engineered decolorationis and construction method thereof
A technology of decolorizing Shewanella and decolorizing Shewanella, which is applied in the fields of biology and environmental engineering, can solve the problems of limited application, and achieve the effects of wide decolorization range, good genetic stability, and convenient tracking and detection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] (1) The total DNA of Shewanella depigmentation S12 and Aeromonas hydrophila DN322 was extracted by conventional methods.
[0036] (2) Acquisition of the NAD(P)H dehydrogenase gene promoter sequence Spr of Shewanella depigmentation S12.
[0037] According to the sequence data of Shewanella sp.ANA-3 genome, the Promoter sequence of reading frame 0316, design primers:
[0038] Upstream primer: prometerEF: 5'TTTTTCTTTTTTATGGGCTA 3';
[0039] Downstream primer: prometerER: 5'TTTAGACATAATCTGCTCCG 3';
[0040] The Promoter sequence of the NAD(P)H dehydrogenase gene was amplified by PCR using the Genomic DNA of Shewanella depigmentation S12 as a template, and named as SNDPromoter (SPr).
[0041] The PCR reaction conditions are as follows: denaturation at 95°C for 4 minutes, followed by 30 cycles: denaturation at 93°C for 30 seconds, annealing at 43°C for 30 seconds, extension at 72°C for 45 seconds, and final extension for 7 minutes. The amplified product is 98 bp. figure 1 ...
PUM
Property | Measurement | Unit |
---|---|---|
molecular weight | aaaaa | aaaaa |
molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap