Check patentability & draft patents in minutes with Patsnap Eureka AI!

Recombinant adenovirus of Survivin promoter regulated human NIS gene, construction method and use

A technology for recombining adenoviruses and promoters, applied in the field of biomedicine, can solve the problems of weak starting ability and narrow range of promoters, etc., and achieve the effects of high recombination efficiency, simplified screening work, and simple operation steps

Inactive Publication Date: 2009-08-12
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the above-mentioned promoters have a narrow range of action and can only target tumor cells that specifically express the promoter gene, or such as the PSA-specific promoter and the ARR2PB promoter can only be used for hormone-dependent prostate cancer cells, but for hormone-independent prostate cancer cells. Dependent prostate cancer cells, their weak priming ability limits the further application of these two promoters to regulate NIS-targeted internal radiation therapy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant adenovirus of Survivin promoter regulated human NIS gene, construction method and use
  • Recombinant adenovirus of Survivin promoter regulated human NIS gene, construction method and use
  • Recombinant adenovirus of Survivin promoter regulated human NIS gene, construction method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Survivin promoter PCR amplification:

[0056] Primers were designed according to the sequence of Survivin DNA (NC 000017) in GeneBank, upstream primer: 5′- AGATCT GCACGCGTTCTTTGAAAGC-3'(-222~-204), downstream primer: 5'- AAGCTT CCACCTCTGCCAACGGGTC-3' (+21-+39), respectively containing BglII and HindIII restriction enzyme sites (synthesized by Shanghai Handsome Biotechnology Co., Ltd.). Using the genomic DNA of PC-3 cells as a template, the Survivin promoter fragment was amplified by PCR, pre-denatured at 95°C for 5 minutes, denatured at 95°C for 30s, annealed at 56°C for 30s, extended at 72°C for 30s, and after 25 cycles, extended at 72°C for 10 minutes. Gel recovery 262bp product fragment, such as figure 1 Shown, the second passage of agarose gel electrophoresis shows the Survivin promoter band that PCR amplification obtains, and size is 262bp; T / A clones to PMD-18T vector (Japan Takara Company), named after PMD-Sur, sequencing (Completed by Shanghai Handsome Biot...

Embodiment 2

[0058] Construction of the luciferase reporter plasmid vector pGL3-Sur-Luc driven by the Survivin promoter, and determination of transcriptional activity:

[0059] PMD-Sur and pGL3-Basic plasmids (promega, USA) were digested with BglI and HindIII, 262bp and 4.8kb fragments were recovered by gel, ligated and transformed into JM109 competent cells, positive clones were selected and named pGL3-Sur-Luc. like figure 1 As shown, the third lane of agarose gel electrophoresis shows the 4.8kb and 262bp bands obtained after pGL3-Sur-Luc was cut with BglII and HindIII.

[0060] Lipofectamine TM In 2000, pGL3-Sur-Luc, pGL3-SV40-Luc, pGL3-Basic and the internal reference plasmid pRL-CMV (the latter three are products of Promega, USA) were co-transfected into the human hormone-dependent prostate cancer cell line LNCaP, human Hormone-independent prostate cancer cell lines DU145 and PC-3, human liver cancer cell HepG2, malignant melanoma cell A375 and normal human dental pulp fibroblast DPF...

Embodiment 3

[0062] Amplification of human NIS gene

[0063] Extract the total RNA of human thyroid tissue according to the operation guide of the kit, synthesize the first strand of cDNA by reverse transcription, and then use this as a template to PCR amplify the codable region of human NIS gene. The primer sequence is NISP1:CCCAAGCTTATGGAGGCCGTGGAGACCGGGGAAC(348-372) NISP2: GCGTCTAGATCAGAGGTTTGTCTCCTGCTG (2259-2280), in which restriction endonuclease HindIII and XbaI sites are added to the 5' ends of the P1 and P2 primers, respectively. The reaction conditions were pre-denaturation at 95°C for 5 min, denaturation at 94°C for 45 s, annealing at 70°C for 30 s, decreasing by 0.5°C per cycle, extension at 72°C for 2 min, and extension for 5 s per cycle, a total of 20 cycles, denaturation at 94°C for 45 s, annealing at 60°C for 45 s, Extend at 72°C for 2.5min, and extend for 5s per cycle. After 15 cycles, extend at 72°C for 10min. Amplified fragments, such as figure 2 As shown, the 1.9Kb b...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Titeraaaaaaaaaa
Login to View More

Abstract

The invention provides a recombined adenovirus constructed by a human sodiumiodide symporter, NIS adjusted and controlled by a survivin promoter and a construction method and application thereof. The method connects nucleotide of a coding human NIS to the lower reach of the survivin promoter which is a broad spectrum tumor specificity promoter; the nucleotide of the coding human NIS and a polyadenylid acid form an expression cassette which is inserted into a non-coding region of the adenovirus so as to construct the recombined adenovirus; the characteristic of the recombined adenovirus which is specifically expressed in a tumor cell and is basically not expressed in a normal cell makes the tumor cell which does not express the protein be capable of taking in radionuclides of iodine and technetium; therefore, the method not only can lead the radionuclides to kill the tumor cell specifically, but also can conveniently and simply carry out quantitative monitoring on the positioning and expression of the gene through image viewing technology.

Description

technical field [0001] The present invention relates to the field of biomedicine, in particular to a recombinant adenovirus capable of highly expressing human sodium iodide symporter (Sodium iodide symporter, NIS) on a Survivin promoter and a construction method thereof, and the recombinant adenovirus Use of viruses in the treatment of a broad spectrum of tumor cells. Background technique [0002] Tumor is a major disease that threatens human life and health. At present, surgery, radiotherapy, and chemotherapy are still the main comprehensive treatment methods. With the deepening and application of medical molecular biology research and the improvement of people's understanding of diseases, gene therapy has gradually become an important part of tumor biotherapeutics. The principle of treatment is to introduce the target gene into target cells by gene transfer technology, so that it can obtain specific functions, and then execute or mediate the killing and inhibition of tumo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N7/01C12N15/12C12N15/861A61K48/00A61P35/00
Inventor 匡安仁黄蕤
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More