Unlock instant, AI-driven research and patent intelligence for your innovation.

Mutational housefly acetylcholinesterase gene and expression vector thereof

A technology of housefly acetylcholinesterase, which is applied in genetic engineering, plant gene improvement, and the use of vectors to introduce foreign genetic materials, etc., can solve problems that affect the repeatability of test results, poor purity and stability, and lack of sensitivity to pesticides. , to achieve the effect of great application value, favorable purification and significant sensitivity

Inactive Publication Date: 2010-05-19
SHANGHAI ACAD OF AGRI SCI
View PDF0 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are mainly two types of enzyme raw materials currently used: one is the pure enzyme preparation of acetylcholinesterase imported from abroad, such as the enzyme derived from electric eel and bovine serum, but the price is relatively high, and it lacks sensitivity to organophosphorus and carbamate pesticides; The second is to directly extract the crude enzyme solution from the insect body, but the purity and stability of this type of enzyme product are poor, which affects the repeatability of the test results

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutational housefly acetylcholinesterase gene and expression vector thereof
  • Mutational housefly acetylcholinesterase gene and expression vector thereof
  • Mutational housefly acetylcholinesterase gene and expression vector thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Example 1 Obtaining of Musca domestica AChE gene sequence

[0048] The total RNA of the housefly was extracted, and the first strand of the total cDNA of the housefly was obtained by reverse transcription. Then use the forward primer Ace-F: 5'-AAA GGATCC (BamHI)ATGGCTAGATCCGTCAG-3' and reverse primer Ace-R: 5'-AAA GAGCTC (SacI)TTACTGGAAGATAGAG-3' was amplified by PCR to obtain the cDNA amplification product of the housefly AChE gene, which was recovered by electrophoresis. The recovered PCR product and the pBbluScipt SK+ vector were double-digested with restriction endonucleases BamHI and SacI respectively, and the digested fragments were connected to transform Escherichia coli DH5α to obtain an Escherichia coli clone containing the AChE cDNA gene sequence. The plasmid containing the AChE cDNA sequence was named PBSK-AChE.

Embodiment 2

[0049] Mutation of embodiment 2AChE gene

[0050] According to the relationship between protein structure and function, we simulated and analyzed the structure of AChE protein, and finally determined to carry out site-directed mutagenesis of amino acids at the following positions:

[0051] For the 262nd amino acid mutation, the following primers were designed:

[0052] A262G-up: 5'GCACAATGAATGCTCCCTGGAGC3'

[0053] mutation site

[0054] A262G-dn: 5'CCGACTGCATCATACCCCATTTGAC3'

[0055] For the 327th amino acid mutation, the following 2 pairs of primers were designed respectively:

[0056] Y327F-up: 5'CCTCCCTCGGCTCCAACCATCGATG3'

[0057] mutation site

[0058] Y327F-dn: 5'ACTTAAAATTCCAGAATACGAGTTC3'

[0059] as well as

[0060] Y327D-up: 5'GATCCCTCGGCTCCAACCATCGAT3'

[0061] mutation site

[0062] Y327D-dn: 5'ACTTAAAATTCCAGAATACGAGTTC3'

[0063] For the 374th amino acid mutation, the following primers were designed:

[0064] I374D-up: 5'GATGATTATTTCGATAAGGATGATG3'

...

Embodiment 3

[0068] The construction of embodiment 3AChE gene expression vector

[0069] According to the multiple cloning site of the zymogen expression vector pPIC9K (purchased from Invitrogen), a pair of primers P1: 5'AAAAGAATTC (EcoRI) ATGACAGATCATCTAACGGTTC3' and P2: 5'AAAAGCGGCCGC (NotI)TTACTGGAAGATAGAGTTGAC3' were designed and synthesized at the 5' end The enzyme cutting sites EcoRI and NotI were introduced respectively. The plasmid containing the AChE gene was used as a template for PCR amplification, and the amplified product was double-digested with EcoRI and NotI, and the digested product was connected with the vector pPIC9K after the same double-digestion, transformed into E. coli competent cells, and picked Positive clones were identified by enzyme digestion and sequenced. figure 2 It is the enzyme digestion identification map of the recombinant expression plasmid. The constructed vectors were named pPIC9K-AChE, pPIC9K-GFD (mutation sites A262G, Y327F and I374D), pPIC9K-GDD...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutational housefly acetylcholinesterase gene which is obtained by gene engineering and an expression vector thereof; compared with the existing SED IDNO.1 amino acid sequence, the expressive protein of the mutational housefly acetylcholinesterase carries out amino acid substitution at 262, 327 and 374 loci. The obtained mutational housefly acetylcholinesterase has high sensitivity to organophosphorus with low concentration and carbamate pesticide and can be used for detecting pesticide residue in farm products, so as to provide more sensitive protein material for development of pesticide biological detection products and have high application value.

Description

technical field [0001] The invention relates to the field of genetic bioengineering, in particular to the mutation of the housefly acetylcholinesterase gene sequence and its expression vector and preparation method. Background technique [0002] Acetylcholinesterase (AChE) mainly exists in the interneurons of multicellular animals and in the chemical synapses between neurons and muscle cells. It is a key enzyme in biological nerve transmission and a major signal transmission molecule. Acetylcholinesterase AChE performs the function of hydrolyzing the neurotransmitter acetylcholine Ach, thereby terminating the excitatory effect of Ach on cholinergic receptors and maintaining the sensitivity of nerve impulse transmission. [0003] Studies have shown that a variety of compounds can inhibit the activity of AChE, resulting in excessive choline-like metabolic pathways in organisms, choline esters cannot be effectively hydrolyzed, and accumulate in large amounts at nerve endings, a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/55C12N9/16C12N15/63C12N1/19C12N5/10C12N1/21C12Q1/46
Inventor 唐雪明谭芙蓉王金斌王利刚朱宏段可赵凯
Owner SHANGHAI ACAD OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More