Mutational housefly acetylcholinesterase gene and expression vector thereof
A technology of housefly acetylcholinesterase, which is applied in genetic engineering, plant gene improvement, and the use of vectors to introduce foreign genetic materials, etc., can solve problems that affect the repeatability of test results, poor purity and stability, and lack of sensitivity to pesticides. , to achieve the effect of great application value, favorable purification and significant sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0047] Example 1 Obtaining of Musca domestica AChE gene sequence
[0048] The total RNA of the housefly was extracted, and the first strand of the total cDNA of the housefly was obtained by reverse transcription. Then use the forward primer Ace-F: 5'-AAA GGATCC (BamHI)ATGGCTAGATCCGTCAG-3' and reverse primer Ace-R: 5'-AAA GAGCTC (SacI)TTACTGGAAGATAGAG-3' was amplified by PCR to obtain the cDNA amplification product of the housefly AChE gene, which was recovered by electrophoresis. The recovered PCR product and the pBbluScipt SK+ vector were double-digested with restriction endonucleases BamHI and SacI respectively, and the digested fragments were connected to transform Escherichia coli DH5α to obtain an Escherichia coli clone containing the AChE cDNA gene sequence. The plasmid containing the AChE cDNA sequence was named PBSK-AChE.
Embodiment 2
[0049] Mutation of embodiment 2AChE gene
[0050] According to the relationship between protein structure and function, we simulated and analyzed the structure of AChE protein, and finally determined to carry out site-directed mutagenesis of amino acids at the following positions:
[0051] For the 262nd amino acid mutation, the following primers were designed:
[0052] A262G-up: 5'GCACAATGAATGCTCCCTGGAGC3'
[0053] mutation site
[0054] A262G-dn: 5'CCGACTGCATCATACCCCATTTGAC3'
[0055] For the 327th amino acid mutation, the following 2 pairs of primers were designed respectively:
[0056] Y327F-up: 5'CCTCCCTCGGCTCCAACCATCGATG3'
[0057] mutation site
[0058] Y327F-dn: 5'ACTTAAAATTCCAGAATACGAGTTC3'
[0059] as well as
[0060] Y327D-up: 5'GATCCCTCGGCTCCAACCATCGAT3'
[0061] mutation site
[0062] Y327D-dn: 5'ACTTAAAATTCCAGAATACGAGTTC3'
[0063] For the 374th amino acid mutation, the following primers were designed:
[0064] I374D-up: 5'GATGATTATTTCGATAAGGATGATG3'
...
Embodiment 3
[0068] The construction of embodiment 3AChE gene expression vector
[0069] According to the multiple cloning site of the zymogen expression vector pPIC9K (purchased from Invitrogen), a pair of primers P1: 5'AAAAGAATTC (EcoRI) ATGACAGATCATCTAACGGTTC3' and P2: 5'AAAAGCGGCCGC (NotI)TTACTGGAAGATAGAGTTGAC3' were designed and synthesized at the 5' end The enzyme cutting sites EcoRI and NotI were introduced respectively. The plasmid containing the AChE gene was used as a template for PCR amplification, and the amplified product was double-digested with EcoRI and NotI, and the digested product was connected with the vector pPIC9K after the same double-digestion, transformed into E. coli competent cells, and picked Positive clones were identified by enzyme digestion and sequenced. figure 2 It is the enzyme digestion identification map of the recombinant expression plasmid. The constructed vectors were named pPIC9K-AChE, pPIC9K-GFD (mutation sites A262G, Y327F and I374D), pPIC9K-GDD...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com