Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

178 results about "Insecticide residue" patented technology

Pesticide residue. Pesticide residue refers to the pesticides that may remain on or in food after they are applied to food crops. The maximum allowable levels of these residues in foods are often stipulated by regulatory bodies in many countries.

Floating type paddy field furrow water quality filtering and recycling integrated device

The application provides a floating type paddy field ridge furrow water quality filtering and recycling integrated device. The floating type paddy field ridge furrow water quality filtering and recycling integrated device comprises a floating water suction head, a ring-shaped floating body assembly for providing floating force, and a water suction assembly suspended in the center of the ring-shaped floating body assembly, the water suction assembly being used for sucking water from the upper layer of a water body; a filtering bin fixedly arranged at the bottom of the ridge furrow, a spiral blade assembly arranged in the inside of the filtering bin along the central axis of the filtering bin, and a filter material reaction layer annularly arranged on the radial outside of the spiral blade assembly; a telescopic flow guide pipe connected with the water suction assembly and the filtering bin and used for guiding water from the floating water suction head into the filtering bin; and a base connected with the bottom of the filtering bin and used for fixing the filtering bin at the bottom of the ridge furrow. The floating type paddy field ridge furrow water quality filtering and recycling integrated device provided by the embodiment of the application can adapt to the change of the water level of the ridge furrow, has low energy consumption, can efficiently remove organic pollutants and pesticide residues, and has the functions of water and fertilizer recycling.
Owner:CHINA INST OF WATER RESOURCES & HYDROPOWER RES

A method for determining a pesticide in a water sample

PendingCN122448952AUv absorbanceAnalyte
The application belongs to the field of pesticide residue detection, and particularly relates to a method for determining pesticides in water samples. The method comprises the following steps: amino modification is performed on MIL-100(Fe) to obtain an amino-functionalized MIL-100(Fe) material; and the pesticides in the water sample are analyzed and detected by using SALDI-TOF-MS with the amino-functionalized MIL-100(Fe) material as a substrate. The application forms a special MOF material by performing amino functionalization modification on MIL-100(Fe), which can enhance the interaction force between the substrate and the analyte, exhibits good ultraviolet absorption and energy transfer capacity, and thus improves the desorption / ionization efficiency in LDI detection. The method is used to detect pesticide residues, and in the low mass region, lower background noise and higher signal intensity are exhibited, so that the detection of pesticide substances in the small molecule region is greatly broken through, and the detection limit is greatly reduced.
Owner:ZHENGZHOU TOBACCO RES INST OF CNTC

Food pesticide residue extraction shaker

The utility model relates to food extraction oscillator technical field, concretely is a kind of food pesticide residue extraction oscillator, including main part, placer, material pipe, regulator, shu block and limiting device, the shu block fixedly connected in the lower surface of main part, the placer is installed in the upper surface of main part, the material pipe is inserted with the inside of placer and is connected, the regulator is installed in the side of main part, the limiting device is fixedly arranged in the side of placer, the limiting device includes limiting plate and limiting block, the limiting block fixedly connected in the side of placer, the limiting plate is installed in the top of placer, the side fixedly connected of limiting plate has moving plate, the moving plate is slidably connected in the inside of limiting block, the moving plate lower end side fixedly connected has baffle. The utility model limiting device, the quick positioning and stable clamping of material pipe are realized, improve the stability of material pipe in the equipment vibration extraction process.
Owner:HENAN GUANJIAN TESTING SERVICE CO LTD

A device for detecting pesticide residues in agricultural products

The utility model belongs to the agricultural product pesticide residue detection technical field discloses a device for detecting agricultural product pesticide residue, including base frame, the base of base frame is opened and has colorimetric card placing groove and optical magnifying glass placing groove, broken jar, broken jar includes broken jar body and the jar cover of sleeve joint installation in the top of broken jar body, the broken structure is integrated on the jar cover, conveying chamber, conveying chamber is installed in the bottom of broken jar body, and the bottom of conveying chamber is threadedly matched and is connected with filter cover, filtrate container, filtrate container can be detachably installed on the base of base frame, and filtrate container is located the just below of conveying chamber, and the base of base frame is opened and has the clamping groove corresponding with filtrate container, and the clamping groove is adapted to filtrate container. The utility model breaks through the space limit of traditional laboratory equipment by integrating the compact base frame of broken, filter, colorimetric analysis function, supports the field fast screening of field, exempts power dependence simultaneously manual operation design, reduces use cost significantly.
Owner:LIXIN NUOKANG (SHANDONG) BIOMEDICAL TECHNOLOGY CO LTD

A pesticide accelerated dissolution device for detecting pesticide residues in fruits and vegetables

ActiveCN224286481Ufast fusionAchieve multi-exercise synergistic dissolution effectPreparing sample for investigationTesting foodAgricultural sciencePesticide residue
This utility model discloses a pesticide accelerated dissolution device for detecting pesticide residues in fruits and vegetables, relating to the field of pesticide detection technology. The device includes a dissolution tank for holding the dissolution solution. Through the arrangement of a rotating cover, a pressure plate, and an eccentric roller, during dissolution, a first drive motor rotates the rotating cover, causing the storage cylinder to move with the cover. A second drive motor rotates the eccentric roller, causing the storage cylinder to intermittently vibrate up and down during rotation. During this vibration, the pressure plate extends into the storage cylinder relative to the cylinder, squeezing the fruits and vegetables. This multi-motion coordinated dissolution effect allows the pesticides in the fruits and vegetables to quickly fuse with the solvent, improving dissolution efficiency and data accuracy.
Owner:JIANGSU HUASHUBIAO TESTING & CERTIFICATION TECH CO LTD

Preparation method of nanoscale enzyme detection reagent for metronidazole residue in apple

This invention relates to a method for preparing a nanozyme detection reagent for carbofuran residues in apples, belonging to the field of pesticide residue and food safety technology. Specific steps: (1) Prepare mesoporous polydopamine powder using polyoxyethylene-polyoxypropylene-polyoxyethylene triblock copolymer, dopamine hydrochloride, etc.; (2) Prepare a copper-manganese bimetallic carbon dot solution using citric acid, copper chloride, manganese chloride, and ethylenediamine; (3) Prepare the nanozyme detection reagent using the mesoporous polydopamine solution and the copper-manganese bimetallic carbon dot solution. Mesoporous polydopamine has a large specific surface area, providing numerous sites for carbon dot loading and effectively adsorbing carbofuran molecules. The copper-manganese bimetallic carbon dots give the nanozyme detection reagent good enzyme-like activity and generate pesticide concentration-dependent colorimetric and photothermal signals. This invention achieves mutual verification of dual-mode output signals, significantly improving detection reliability; and completes detection within 1.5 h.
Owner:HEFEI UNIV OF TECH

Attractant for telenomus remus nixon to control spodoptera litura fabricius, and acquisition method thereof

PendingUS20260150840A1BiocidePest attractantsPesticide residueChemical control
An attractant for Telenomus remus Nixon to control Spodoptera litura Fabricicus is provided. The attractant includes a solvent and at least one of the following components: 1,3-dichlorobenzene, benzothiazole, and octane. The attractant can effectively attract Telenomus remus Nixon to parasitize Spodoptera litura Fabricius eggs, such that the growth of a pest quantity is inhibited and the pest population gradually dies out, which achieves the purpose of pest control. The attractant is a green, non-toxic, and pollution-free attraction substance. Therefore, the attractant can solve a series of problems such as pesticide residues, environmental pollution, and food safety caused by chemical control, and is of great significance for the green control of Spodoptera litura Fabricius.
Owner:YUNNAN TOBACCO CO LTD KUNMING BRANCH +1

A strain of Acetobacter peroxide 672 and its application

PendingCN122081146Ahigh antagonistic activityImprove disease resistanceBiocidePlant growth regulatorsPlant rootsPesticide residue
This invention belongs to the field of microbial technology, specifically relating to a strain of Acetobacter peroxide 672 and its applications. The Acetobacter peroxide 672 strain of this invention can enhance the antagonistic activity of Pichia pastoris against Rhizoctonia solani and also antagonizes Colloidal anthracnose, providing a multi-faceted solution for the biological control of crop diseases. Furthermore, the strain possesses the ability to produce indoleacetic acid, which can significantly promote the growth and development of grain crops such as wheat and corn, promote root expansion, enhance nutrient and water absorption, and thus effectively increase biomass. In addition, the strain can tolerate and degrade chemical pesticide components such as imidacloprid and carbendazim, alleviating soil pesticide residue pollution, and can effectively alleviate the inhibitory effects of low pH stress on crops, enhancing their stress resistance. Therefore, the Acetobacter peroxide 672 strain of this invention has significant application value in the biological control of crop diseases, crop growth promotion, soil pesticide residue remediation, and enhancing crop stress resistance.
Owner:JILIN UNIVERSITY +1

A portable rapid detector for pesticide residues in food

This utility model discloses a portable rapid detector for pesticide residues in food, comprising: a sample container, a tube head integrally installed on the top of the sample container, and a top cover installed above the tube head. A threaded sleeve is fixedly connected to the bottom surface of the top cover, and a docking hole is hollowed out in the middle of the top cover. A cap is installed on the top of the top cover by connecting bolts, and a reagent tube is installed inside the docking hole. The reagent tube is continuously fed into the sample container through the threaded connection structure between the top cover and the sample container. A rubber stopper is provided at the bottom of the reagent tube. Inserting the tube will puncture the rubber stopper at the bottom of the reagent tube. A through hole is provided on the surface of the inserting tube. After the inserting tube is inserted into the reagent tube, the reagent will flow into the sample container through the through hole on the surface of the inserting tube. After shaking the sample container, the reagent comes into contact with the agricultural product sample. Pesticide residues will cause the reagent to produce a color reaction. The color reaction is observed through the observation window on the surface of the sample container. The presence of pesticide residues can be quickly determined after the color reaction occurs.
Owner:思茅海关综合技术服务中心 +1

A genetic control method for monochamus alternatus

PendingCN122168456ABiocideBacteriaAdult stagePesticide residue
The application provides a method for preventing and treating monochamus alternatus, which comprises putting male monochamus alternatus carrying Wolbachia into a target prevention and treatment area of monochamus alternatus not carrying Wolbachia. The method has low investment cost, is green, safe, environment-friendly, has no pesticide residue and high risk, conforms to the green prevention and control principle and needs of diseases and pests in the new era, is less affected by external temperature, humidity and other climate environments, is suitable for wide plots, is a new prevention and treatment method, is early in the prevention and treatment period, prevents and treats from the egg stage, reduces the double hazards of the larval stage dry woodworm and the pupal stage adult stage spreading pine wood nematode disease from the root, has good prevention and treatment effect, and can significantly reduce the egg hatching rate of monochamus alternatus by more than 90%.
Owner:INST OF ZOOLOGY CHINESE ACAD OF SCI +1

A pollution-free green agricultural product standardized planting management method

PendingCN122453079AContinuous croppingPesticide residue
The application belongs to the technical field of green plant protection cultivation, and discloses a standardized planting and management method for pollution-free green agricultural products, which realizes multi-index screening of soil heavy metals, pesticide residues, microorganisms and water, soil and air, establishes a soil plant protection database, and applies passivation materials, compound beneficial microorganism groups and decomposed organic fertilizers to the soil according to pollution, continuous cropping and short soil fertility, and improves the stress resistance of seedlings by matching seed pretreatment; the disease and pest risk grades of plots are divided by weighting and quantifying five types of planting data, and a risk map is drawn, high, medium and low risk plots are differentially configured with pest-resistant varieties, intercropping, crop rotation and pest-repellent crops, and a hierarchical prepared prevention and control mechanism is matched, the planting environment is optimized from the aspects of farmland basement and field ecological layout; through the fusion of the Internet of Things, unmanned aerial vehicle remote sensing, pest trapping and meteorological data, the early latent characteristics of diseases and pests are captured through a deep learning model, and the development trend of diseases and pests is deduced in advance and divided into three levels of early warning.
Owner:GANSU SHENGHEHUI AGRICULTURE & ANIMAL HUSBANDRY TECHNOLOGY CO LTD

A fungicide composition for preventing and treating gummy stem blight of melon

PendingCN122250459ADelay the accumulation of drug resistanceOvercoming problems in preventing and controlling melon vine blightBiocideFungicidesFungicidePesticide residue
The present application belongs to the technical field of pesticides, and particularly relates to a fungicide composition for preventing and treating vine gummy stem blight. The fungicide composition for preventing and treating vine gummy stem blight is prepared by compounding thymol with monensin sodium or physcion methyl ether as effective components. The fungicide composition of the present application has different fungicidal mechanisms of thymol, monensin sodium and physcion methyl ether, and the combination of the three components can delay the accumulation and development of pathogenic fungi resistance, and effectively overcome the problems existing in the prevention and treatment of vine gummy stem blight by using single-component pesticides. In addition, the effective components of the fungicide composition of the present application have a synergistic effect on vine gummy stem blight, can improve the prevention and treatment effect on vine gummy stem blight, help to reduce the application dose of the pesticide, and effectively overcome the problems of pesticide residue exceeding the standard and environmental pollution. Furthermore, thymol, monensin sodium and physcion methyl ether in the fungicide composition of the present application are environmentally friendly and green.
Owner:桂林市农业科学研究中心

A method for improving postharvest resistance to black rot and maintaining quality of sweet potato tubers

PendingCN122074546Ainhibit expansionIncreased resistance to black spot diseaseFruit and vegetables preservationBiotechnologyPesticide residue
This invention discloses a method for improving the resistance to postharvest black spot disease in sweet potato tubers and maintaining their quality, belonging to the field of postharvest preservation technology for agricultural products. The method includes: selecting undamaged sweet potato tubers for callus treatment at room temperature for 48 hours, disinfecting with 1% sodium hypochlorite, rinsing with sterile water and air-drying, then soaking them in a 9.0 mmol / L benzothiadiazole (BTH) solution (containing 0.05% Tween 80) at room temperature for 60 minutes, removing them and air-drying them to complete the treatment. This invention induces the activation of the sweet potato tuber's own defense system through BTH, increasing the activity of key enzymes in phenylpropane metabolism, chitinase and other disease-resistant enzymes, promoting the accumulation of total phenols and lignin, maintaining cell membrane integrity, inhibiting starch degradation and abnormal increase in soluble sugars. Under storage conditions of 28±1℃ and 80-85%RH, it can significantly inhibit the expansion of black spot disease lesions and extend the storage period to more than 25 days. This method has no pesticide residues, is unlikely to cause pathogen resistance, is environmentally friendly, simple to operate, and cost-controllable, and is suitable for large-scale postharvest preservation of sweet potato tubers.
Owner:ZHEJIANG FORESTRY UNIVERSITY

A bactericidal composition containing bronopol and its use

ActiveCN120154005BBronopolPesticide residue
The application belongs to the technical field of pesticides, and discloses a kind of fungicidal composition containing bromonitril and purposes thereof, the fungicidal composition contains active ingredient A and active ingredient B, the active ingredient A is bromonitril, the active ingredient B is selected from any one of fluazinam, isopyrazam or carboxin, and the mass ratio of the active ingredient A to the active ingredient B is 1:35-35:1.The fungicidal composition has high activity on diseases on various crops, has significant synergistic effect, is superior to single agent in terms of quick-acting property and persistence, simultaneously reduces the use amount of pesticide in agricultural production, reduces pesticide residues in agricultural products, delays the generation of pathogenic bacteria resistance, and is beneficial to the comprehensive management of agricultural diseases.
Owner:QINGDAO HAILIER BIOTECHNOLOGY CO LTD

Insecticidal compositions comprising isoxazoline substituted benzamide compounds and uses thereof

The present application belongs to the technical field of pesticides, and particularly relates to an insecticidal composition containing an isoxazoline-substituted benzamide compound and application thereof. The insecticidal composition contains active ingredient A and active ingredient B, wherein the active ingredient A is oxadiazylfluazaim or the active ingredient B is one or more selected from the following compounds: fluoromethane sulfide, pyridaben and fluoromethane bisether. The composition has reasonable components, good insecticidal effect, low pesticide cost, and the characteristics of reducing the application amount, being safe to crops, reducing the amount of pesticide residues, etc.
Owner:JIANGSU KINGAGROOT WEED MANAGEMENT CO LTD

Microbial composition, complex microbial inoculant and application thereof

ActiveCN121362663BRealize full life cycle protectionSolve the problem of preventing and controlling rice blast diseaseBiocideFungiBiotechnologyMicrobial agent
The present application relates to the technical field of microorganism, and particularly relates to a microbial composition, a compound microbial agent and application.The microbial composition of the present application comprises Bacillus amyloliquefaciens, Bacillus brevis and Trichoderma harzianum, the microbial composition of the present application can simultaneously prevent and treat rice seed production process rice blast and storage process aspergillus flavus pollution, realize the whole life cycle protection of rice seed from production to storage, solve the problem that different agents need to be used to prevent and treat rice blast and aspergillus flavus pollution in the prior art.In addition, the compound microbial agent containing the microbial composition is safe, efficient, environmentally friendly, can replace chemical pesticides, reduce environmental pollution and pesticide residues, and the preparation method is simple, easy to industrial production, and has wide application prospect.
Owner:BEIJING LANTU TECH CO LTD

Microwave digestion instrument for pesticide sample pretreatment

The application relates to a microwave digestion instrument for pesticide sample pretreatment and relates to the technical field of pesticide residue detection. The microwave digestion instrument comprises a shell, the bottom of the shell is fixedly connected with a device seat, the top of the shell is provided with a controller, the outside of the shell is provided with a protection mechanism, the inside of the shell is provided with a heating mechanism, the outside of the device seat is provided with a dissipation mechanism, the protection mechanism comprises a rotating seat, the outside of the rotating seat is fixedly connected to the right side of the outside of the shell, the outside of the rotating seat is rotationally connected with an inner door, the outside of the inner door is fixedly connected with a pressing part, the left side of the outside of the shell is fixedly connected with an opening and closing seat, and the outside of the opening and closing seat is rotationally connected with an outer door. The application has the advantages that the inner door is driven to rotate through the rotating seat, the outer door is driven to rotate through the opening and closing seat, one side of the pressing part is supported on the outside of the shell, and the other side of the pressing part is supported on the outer door, so that the inner door and the outer door are tightly combined with the shell, and the sealing effect is improved.
Owner:SHANGHAI DEYI TESTING TECH CO LTD

Integrated agricultural product pesticide residue crushing and extraction device

ActiveCN224404431Ureduce connectivityReduce transfer stepsAgricultural sciencePesticide residue
The utility model relates to the field of pesticide residue treatment, specifically is a kind of integrated agricultural product pesticide residue crushing extraction equipment, including extraction cylinder, the inside of extraction cylinder is sequentially opened with crushing chamber, control chamber and stirring chamber from top to bottom, heating unit is fixedly arranged on extraction cylinder and is matched with stirring chamber, the side portion of extraction cylinder is provided with centrifuge, and the bottom end of stirring chamber is communicated with centrifuge;The integrated agricultural product pesticide residue crushing extraction equipment of the utility model integrates multiple functions such as crushing, stirring, heating, centrifugal separation in one, realizes the full-process automation operation from agricultural product feed to residue extraction, separation, reduces the connection and transmission steps between multiple devices in traditional equipment, improves work efficiency, saves space.
Owner:安阳市产品质量检验检测中心

A rapid detection device for pesticide residues

The application discloses a kind of pesticide residue rapid detection device, comprising: body and rapid detection component, the body is rectangular body shape structure, the rapid detection component is arranged in one side of body, the rapid detection component includes plug-in slot, the number of plug-in slot is three and symmetrically opened in one side of body, the inner wall of plug-in slot is inserted with plug-in frame, the plug-in frame can be inserted in the inner wall of plug-in slot under the action of rapid detection component, in turn, pesticide residue can be detected by cooperating detection test paper, while detection test paper can be conveniently and quickly replaced under the cooperation of cover plate and plug-in frame, and the solution after sampling can be detected on detection test paper, the whole process is simple and fast, without multiple equipment cooperation, so that the detection step is reduced, and then the detection effect is improved.
Owner:CHONGQING ACAD OF METROLOGY & QUALITY INST

Nucleic acid aptamer for simultaneously recognizing three pyrethroid pesticides, evaluation method and application thereof

PendingCN122382073AAptamerNucleotide
The application discloses a nucleic acid aptamer for simultaneously identifying three pyrethroid pesticides and an evaluation method and application thereof, the nucleic acid aptamer is nucleic acid aptamer seq-7, and the nucleotide sequence is 5'-GCCATCTTTGATTGGAATGGCGGTGTCCGTGTTGCGCCATCGTCGGAGG CAAGATCAAGGTTGTGGCACC-3'. The nucleic acid aptamer is screened based on the Capture-SELEX technology, and the nucleic acid aptamer can simultaneously combine lambda-cyhalothrin, cyfluthrin and fenvalerate with high affinity, the application effectively overcomes the limitation that the existing nucleic acid aptamer technology can only identify a single pyrethroid pesticide, and provides a new method and new technology for simultaneously detecting and screening the three pesticide residues rapidly, at low cost, with high sensitivity and without interference. The aptamer not only has high specificity and affinity, but also can accurately detect the target pesticide in a complex sample background, remarkably improves the detection efficiency, reduces experimental cost and time, promotes the development of rapid detection technology, and has a wide application prospect.
Owner:HUAZHONG AGRI UNIV

High-efficiency sample pesticide residue detection device

ActiveCN224553081UCuvettePesticide residue
The utility model provides a kind of efficient sample pesticide residue detection device, belong to pesticide residue detection technical field. Including detection device ontology, still include: quick assembly and disassembly component, quick assembly and disassembly component is placed in the side of detection device ontology, quick assembly and disassembly component includes the clamping plate being arranged in the side of detection device ontology, the inside of clamping plate is provided with cuvette, cuvette is array distribution on clamping plate, and the side close to clamping plate on cuvette is provided with elastic clamping plate;Portable component;By setting quick assembly and disassembly component, when cuvette is inserted and mounted to clamping plate, elastic clamping plate extrudes cuvette by the help of self elastic force, to be firmly fixed in clamping plate, achieve the integration effect of cuvette and clamping plate, push clamping plate, cuvette will move synchronously with clamping plate, insert and mount on clamping plate, after detection is completed, cuvette can also be taken out synchronously with clamping plate, reduce the repeated action in operation, improve the efficiency of detection process.
Owner:富源县后所镇农业农村发展服务中心

Microbial agent for preventing and treating botrytis cinerea of crops and preparation method and application thereof

The present application belongs to the technical field of biological control, and particularly relates to a microbial agent for preventing and treating gray mold of crops, and a preparation method and application thereof. The present application provides a microbial agent for preventing and treating gray mold of crops, which comprises a microbial strain and / or a fermentation broth of the microbial strain; the microbial strain comprises one or more of Bacillus subtilis JD-L9, Pseudomonas lundensis DS-PZ-P18 and Pseudomonas chlororaphis HQ-CZ-P12; wherein the Pseudomonas chlororaphis HQ-CZ-P12, the Pseudomonas lundensis DS-PZ-P18 and the Bacillus subtilis JD-L9 have a good inhibition rate on the pathogenic fungus of gray mold, and after being compounded into a compound microbial agent, the compound microbial agent is sprayed on seedlings of medicinal materials, so that the incidence of gray mold during seedling raising is significantly reduced, pesticide residues of the medicinal materials are reduced, and the safety of the medicinal materials is improved.
Owner:远大种业(甘肃)有限公司

A rapid detection system for pesticide residues in grain

The present application relates to the technical field of pesticide detection, and particularly relates to a rapid detection system for pesticide residues in grain. A portable device such as a mobile phone is used to collect an image of a reaction area of a detection reagent, and a standardized sub-image set of a sample detection area, an environmental reference area and a concentration reference area is obtained by segmentation. After the environmental reference correction image, the concentration reference area data is fitted to generate a dynamic calibration curve and calculate the goodness of fit. A high-dimensional visual feature vector of the sample area is extracted, a pre-trained model is input in combination with the calibration curve, and an estimated concentration of pesticide residues and an abnormality determination result are obtained. Finally, the overall confidence is calculated by comprehensively considering multiple indexes, and a standard detection report is generated according to a threshold value. The present application can realize rapid and accurate detection of pesticide residues in grain in a complex scene.
Owner:黑龙江省粮食质量安全监测和技术中心

Agricultural product pesticide residue micro-extraction pretreatment device and detection method

The application relates to the technical field of agricultural product quality and safety detection, and discloses a pesticide residue micro-extraction pretreatment device for agricultural products, which comprises a base, a sliding column is fixedly installed at the top of the base, a control driving assembly, a chopping and stirring assembly, a centrifugal assembly and a filtering assembly are arranged outside the sliding column, a fixing disc is fixedly installed outside the sliding column, a driving box is fixedly installed at the top of the fixing disc, and two driving gears and one transmission gear are rotationally connected in the driving box. The pesticide residue micro-extraction pretreatment device for agricultural products and the detection method integrate the chopping and stirring assembly, the control driving assembly, the centrifugal assembly and the filtering assembly into one through the single vertical main body structure formed by the base and the sliding column, a single servo motor synchronously drives the core working procedure through the transmission gear and the driving gear, there is no separate independent equipment, and the whole machine is compact and can be integrally moved.
Owner:WUWEI VOCATIONAL COLLEGE

A fusarium oxysporum cell wall extract, its preparation method and use

PendingCN122444892ABiotechnologyPhenylpropanoid
This invention relates to the field of plant disease biological control technology, and particularly to a Fusarium oxysporum cell wall extract, its preparation method, and its application. The extract is derived from the polysaccharide fraction of the cell wall of Fusarium oxysporum spores or hyphae, and contains at least one pathogen-associated molecular pattern (PAMP) component. This component is a non-protein, thermally stable, species-nonspecific elicitor capable of forming an aqueous dispersion system. The extract of this invention can be recognized by plant PRRs and activate PTI immunity. Rehmannia glutinosa tubers treated with the extract showed a significantly increased germination rate after inoculation with Fusarium oxysporum. It also induces superoxide anion production, upregulates the activities of superoxide dismutase, peroxidase, and catalase, and enriches differentially expressed genes in the MAPK signaling pathway, jasmonic acid metabolism pathway, and phenylpropane biosynthesis pathway. Furthermore, the extract can directly inhibit Fusarium oxysporum colony expansion, conidia production, and mycelial growth. Extracts derived from spores or hyphae show no significant difference in inducing disease resistance, and the raw materials are flexible and easy to industrialize. This extract is derived from the cell wall of the pathogen itself, making it environmentally friendly and free from the risk of chemical pesticide residues. It is suitable for the green control of root rot disease in Rehmannia glutinosa.
Owner:HENAN NORMAL UNIV

Method for removing pesticide residues from ginger oleoresin

ActiveCN116474415BPesticide residueOleoresin
The present application provides a kind of method for removing pesticide residue in ginger oleoresin, the method comprises the following steps: (1) with fatty acid as entrainer, organic phosphorus pesticide and ginger essential oil in ginger oleoresin raw material are separated by supercritical carbon dioxide extraction method;Wherein, extraction pressure is 10-18MPa, extraction temperature is 35-70 DEG C;(2) with ginger essential oil as entrainer, the material remaining in supercritical carbon dioxide extraction device in step (1) is extracted, and pesticide-free ginger oleoresin is separated;Wherein, extraction pressure is 18-40MPa, extraction temperature is 35-70 DEG C.The present application process is simple, low in cost, can be effectively applied to large-scale production, solve the problem that pesticide residue in ginger oleoresin product is overproof, gingerol content and pesticide residue can be completely separated, and clean, safe ginger extract product is prepared.
Owner:CHENGUANG BIOTECH GRP CO LTD +1

A between-row weeder

This invention discloses an inter-plant weeding machine, belonging to the technical field of weeding equipment. It includes: a frame with rotatable wheels on both sides; a crossbar located at the front of the frame, with two connecting frames slidably mounted on the crossbar. A rotating shaft is rotatably connected to each connecting frame, and a main weeding roller is mounted on the rotating shaft. A driven roller adapted to the main weeding roller is also mounted on each connecting frame; two drive mechanisms and two linkage mechanisms are all mounted on the frame. This invention uses the drive mechanisms to rotate the rotating shaft and the main weeding roller, which, in conjunction with the driven rollers, clamps and pulls out weeds, achieving continuous weeding without the use of herbicides and pesticide residues. It also better replaces manual weeding, significantly improving work efficiency. The driving wheels drive the linkage mechanisms, causing the two connecting frames to reciprocate along the crossbar in opposite directions / away from each other, allowing the main weeding roller and driven roller to enter between crop plants to remove weeds in the gaps between plants, significantly improving the weeding effect.
Owner:ANHUI AGRICULTURAL UNIVERSITY