Unlock instant, AI-driven research and patent intelligence for your innovation.

Albumin/keratin double expression mice embryonic stem cell system and establishing method thereof

A mouse embryo and keratin technology, applied in the field of genetic engineering, can solve the problems of identifying the surface marker proteins of hepatic progenitor cells, difficulty in tracking and sorting hepatic progenitor cells, and inability to accurately demarcate hepatic progenitor cells, etc. Practical, simple effect

Active Publication Date: 2013-04-10
CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In previous reports on the differentiation of ES cells into hepatic progenitor cells, AFP was linked to EGFP as a marker gene of hepatic progenitor cells, and the appearance of hepatic progenitor cells was proved by detecting the expression of AFP, but in fact, AFP is not only It is only expressed in hepatic progenitor cells, and it is also highly expressed in visceral endoderm, which eventually differentiates into extraembryonic tissues and does not participate in the differentiation and development of the liver, so the expression of AFP cannot accurately identify hepatic progenitor cells The presence
So far, there is still no recognized surface marker protein for identifying hepatic progenitor cells, so this brings certain difficulties to the tracking and sorting of hepatic progenitor cells differentiated from ES cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Albumin/keratin double expression mice embryonic stem cell system and establishing method thereof
  • Albumin/keratin double expression mice embryonic stem cell system and establishing method thereof
  • Albumin/keratin double expression mice embryonic stem cell system and establishing method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0053] Example 1 , carrier construction

[0054] 1.1. Construction of pcDNA3.1-mAlb-mRFP / hygro(-) vector

[0055] 1.1.1. Design the following PCR primers according to the sequence of plasmid pDB587 to amplify mRFP:

[0056] P1: 5'ACGCGGCCGCAGATCCACCATGGCCAGCTCCG3'

[0057] P2: 5'CTCAAGCTTTTAGCTTCCAGCGCCTGTGCTATGT3'

[0058] 1.1.2, PCR amplification

[0059] The plasmid pDB587 was used as a template, and P1 and P2 were used as primers for PCR amplification, as follows:

[0060] Reaction system (50 μl): 10×Buffer 5 μl, dNTP (100 μmol / L) 4 μl, MgSO 4 (50mM) 2μl, HIFI DNA polymerase 0.5μl, P1, P2 (10μM) each 1μl, ddH 2 O35.5 μl.

[0061] Reaction conditions: 94°C, 3min; 94°C 30sec, 62°C 30sec, 68°C 60sec, cycle 25 times; 72°C, 10min.

[0062] 1.1.3. Construction of pcDNA3.1-mRFP / hygro vector

[0063] The resulting PCR product was subjected to agarose gel electrophoresis, and the mRFP fragment of about 692 bp was recovered using a kit from QIAGEN, and double-digested with...

Embodiment 2

[0091] Example 2 , ALB and CK19 promoter tissue-specific expression

[0092] 2.1. Plasmid extraction

[0093] The four vectors constructed in Example 1 were used to extract the plasmids according to the instructions of the QIAGEN company's large extraction kit for future use.

[0094] 2.2. Cell transfection

[0095] The day before transfection, human liver cancer cells Huh7, mouse fibroblasts NIH-3T3, and human cholangiocarcinoma cells GBC-SD (all purchased from the Cell Bank of Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences) were spread on 6-well plates. When the cells grow to 60%-80% confluence, use the QIAGEN transfection kit to mix the plasmid obtained in step 2.1 with 8 μl enhancer, place at room temperature for 5 minutes, add transfection reagent and mix 5 times, place at room temperature for 8 minutes, and mix with Mix 1ml of the culture medium, and add it to the cell culture medium respectively as shown in Table 1. After 24-48 hour...

Embodiment 3

[0099] Example 3 , Establishment of mouse embryonic stem cell lines

[0100] 3.1. Plasmid linearization

[0101] Take 5 μg each of the vectors pcDNA3.1-mAlb-mRFP / hygro(-) and pcDNA3.1-mCK19-hCD25-IRES-tdTOMATO / hygro(-) constructed in Example 1, add 2 μl of Nru I, and digest overnight at 37°C ; Take 5 μg each of pmalb-EGFP-N2 and pmCK19-EGFP, add 2 μl of Apal I, and digest overnight at 37°C. Add 1 / 10 volume of sodium acetate to the obtained digested product and mix well, add 4 μl of DNAmate, 2.5 times the volume of -20°C ethanol, mix well, centrifuge at 13,000 rpm at 4°C for 15 minutes to obtain a white precipitate, dissolve it in sterile water for later use.

[0102] 3.2 Culture of mouse embryonic stem cells

[0103] Embryonic stem cells E14.1 (purchased from ATCC, deposit number CRL-1821) were cultured in a culture flask without a feeder layer but covered with 0.1% gelatin, and 10% KO-serum, 1% FBS, 100×P / S, 100× non-essential amino acids, 0.1mM β-mercaptoethanol, 1mM so...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an albumin / keratin double expression mice embryonic stem cell system and an establishing method thereof. The mice embryonic stem cell system of the invention is established by sub-culturing the albumin / keratin double expression mice embryonic stem cell. The mice embryonic stem cell is integrated with a red fluorescence / green fluorescence protein double reporter gene, wherein the reporter gene is regulated by tissue specificity promoter albumin ALB or keratin CK19. Compared with a method of inputting genes, the method of controlling the reporter gene by using the transfection tissue specificity promoter of the invention is more simple, rapid and useful. The uniform originator cells in the developmental stage can be precisely chosen by using the albumin / keratin double expression mice embryonic stem cell of the invention, which can bring a great beneficial effect to the following research on the originator cell differentiation, the cell transplanting and cure.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to an albumin / keratin (ALB / CK19) double-expression mouse embryonic stem cell line and a method for establishing the same. Background technique [0002] Embryonic stem cells (ESCs) are totipotent stem cells isolated from the inner cell mass of mammalian blastocysts, which can proliferate indefinitely and differentiate into more than 200 cell types throughout the body. Embryonic stem cells can form embryoid bodies (EBs) in suspension culture. Embryooid bodies are spheres similar to early embryos formed spontaneously by embryonic stem cells under certain conditions in vitro. The formation and differentiation of the three germ layers basically simulate the early development of embryos in vivo. The differentiation process of tissue cells. In 1996, Japanese scholar Abe et al. first detected the expression of endoderm genes during embryoid body development, and its expressio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N5/10
Inventor 王欣李阳芳
Owner CENT FOR EXCELLENCE IN MOLECULAR CELL SCI CHINESE ACAD OF SCI