Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Yeast expression system for expressing glycosylated interferon and method for preparing recombinant glycosylated interferon

A kind of yeast expression system, technology of expression system

Inactive Publication Date: 2010-09-15
刘振平
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this system also has several defects: ① Lack of post-translational modification and processing of eukaryotic proteins, such as cleavage, glycosylation, and formation of disulfide bonds; ② Most of the expressed proteins exist in the form of inclusion bodies, which require The conformation and activity can only be restored after complex renaturation; ③ There are many background impurities, and purification is troublesome; ④ The expression level is generally not very high
However, the yield of yeast expression is extremely low (generally less than 1mg / L), further increasing the expression of protein is the first condition for reducing costs and large-scale production, and it is also the reason why it is difficult to realize the industrialization of yeast expression IFN

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Yeast expression system for expressing glycosylated interferon and method for preparing recombinant glycosylated interferon

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] Example 1 Construction and expression of recombinant glycosylated interferon Pichia pastoris expression system (PKLN-2)

[0039] Pichia pastoris is a kind of methanol yeast. Compared with animal and plant systems, it has the advantage of simple operation; unlike prokaryotic Escherichia coli, etc., Pichia pastoris can correctly fold the protein to be expressed, so it has Natural biological activity; in addition, this methanol yeast can achieve high-density fermentation, and its transformants can express foreign proteins very stably, which is more suitable for industrial production. Therefore, in the present invention, Pichia pastoris is selected as the expression host bacterium of rIFN.

[0040] 1. PCR amplification of IFN gene

[0041] 1.1 Extraction of genomic DNA from human blood leukocytes

[0042] Methods The conventional extraction method was used: the fresh blood was treated with D-citric acid, and the leukocytes were centrifuged. Suspend leukocytes in extracti...

Embodiment 2

[0081] Example 2 Construction and expression of recombinant glycosylated interferon Pichia pastoris expression system (pPIC9K)

[0082] 1. PCR amplification of IFN gene

[0083] 1.1 Extraction of genomic DNA from human blood leukocytes

[0084] The preparation method is the same as in Example 1.

[0085] 1.2 Primer design and synthesis and PCR reaction

[0086] The gene sequence of IFN reported in reference literature (Ullrich A, Gray A, Berman C, et al, Nature, 1983, Vol.303, 821-825), we designed and synthesized a pair of primers for easy cloning and expression. EcoRI and Xba I restriction sites were introduced at the ends respectively, and the primers were as follows:

[0087] P1: 5'CC GAATTC TTATCTCACAGCTTCCTGCT 3'

[0088] P2: 5'CG TCTAGA TCAGGCTCTTTCCACAGC 3'

[0089] The normal human blood leukocyte genomic DNA extracted above was used as a template, and PCR amplification was carried out with primers P1 and P2 respectively. The amplification conditions were: de...

Embodiment 3

[0108] Example 3 Fermentation and purification of recombinant glycosylated interferon Pichia pastoris (PKLN-2)

[0109] In this example, the yeast engineered strain PKLN-2 constructed in Example 1 is preferably used for fermentative expression of rIFN.

[0110] 1. Activation of strains

[0111] Take the frozen glycerol strain, mark the YPD plate, and incubate at 28°C for 48h to activate.

[0112] 2. Primary seed cultivation

[0113] Take 50mL of BMG shake flask culture medium, insert the activated colony on the YPD plate, shake and culture at 28°C and 250rpm for 24h, until the bacterial solution OD 600 It is around 11.

[0114] 3. Secondary seed cultivation

[0115] Take fresh BMG medium (volume is 10% of the volume of the base material in the upper tank), add the first-level seed solution to the second-level seed solution at 1-2%, and add 10×YNB and 500×Biotin to the seed solution before inoculation , 28°C, 250rpm shaking culture for 24h, to the OD of the bacterial solut...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a new yeast expression system for expressing glycosylated interferon, which has the advantages that the expression yield is high, a product has natural structure and biological activity and does not need to denaturalize or renature, a culture medium is simple and cheap; thermogenic substances are reduced, the yield is markedly improved, the production cost is greatly lowered and the like. The invention also provides a method for preparing the recombinant glycosylated interferon by utilizing the expression system.

Description

technical field [0001] The invention relates to a novel recombinant vector for expressing glycosylated interferon (IFN) and its yeast expression host, and also relates to a method for preparing recombinant glycosylated interferon using the yeast expression system. Background technique [0002] Interferon (IFN for short) Interferon (IFN) is a broad-spectrum antiviral agent that does not directly kill or inhibit the virus, but mainly through the action of cell surface receptors to make cells produce antiviral proteins, thereby inhibiting the replication of hepatitis B virus At the same time, it can also enhance the vitality of natural killer cells (NK cells), macrophages and T lymphocytes, thereby playing an immune regulatory role and enhancing antiviral ability. Interferon is a group of active proteins with multiple functions (mainly glycoprotein), a cytokine produced by monocytes and lymphocytes. They have broad-spectrum anti-virus, affect cell growth, differentiation, regu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/81C12N1/19C12N15/20C07K14/555
Inventor 刘振平王加旺张大伟
Owner 刘振平
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More