Yeast expression system for expressing glycosylated interferon and method for preparing recombinant glycosylated interferon
A kind of yeast expression system, technology of expression system
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0038] Example 1 Construction and expression of recombinant glycosylated interferon Pichia pastoris expression system (PKLN-2)
[0039] Pichia pastoris is a kind of methanol yeast. Compared with animal and plant systems, it has the advantage of simple operation; unlike prokaryotic Escherichia coli, etc., Pichia pastoris can correctly fold the protein to be expressed, so it has Natural biological activity; in addition, this methanol yeast can achieve high-density fermentation, and its transformants can express foreign proteins very stably, which is more suitable for industrial production. Therefore, in the present invention, Pichia pastoris is selected as the expression host bacterium of rIFN.
[0040] 1. PCR amplification of IFN gene
[0041] 1.1 Extraction of genomic DNA from human blood leukocytes
[0042] Methods The conventional extraction method was used: the fresh blood was treated with D-citric acid, and the leukocytes were centrifuged. Suspend leukocytes in extracti...
Embodiment 2
[0081] Example 2 Construction and expression of recombinant glycosylated interferon Pichia pastoris expression system (pPIC9K)
[0082] 1. PCR amplification of IFN gene
[0083] 1.1 Extraction of genomic DNA from human blood leukocytes
[0084] The preparation method is the same as in Example 1.
[0085] 1.2 Primer design and synthesis and PCR reaction
[0086] The gene sequence of IFN reported in reference literature (Ullrich A, Gray A, Berman C, et al, Nature, 1983, Vol.303, 821-825), we designed and synthesized a pair of primers for easy cloning and expression. EcoRI and Xba I restriction sites were introduced at the ends respectively, and the primers were as follows:
[0087] P1: 5'CC GAATTC TTATCTCACAGCTTCCTGCT 3'
[0088] P2: 5'CG TCTAGA TCAGGCTCTTTCCACAGC 3'
[0089] The normal human blood leukocyte genomic DNA extracted above was used as a template, and PCR amplification was carried out with primers P1 and P2 respectively. The amplification conditions were: de...
Embodiment 3
[0108] Example 3 Fermentation and purification of recombinant glycosylated interferon Pichia pastoris (PKLN-2)
[0109] In this example, the yeast engineered strain PKLN-2 constructed in Example 1 is preferably used for fermentative expression of rIFN.
[0110] 1. Activation of strains
[0111] Take the frozen glycerol strain, mark the YPD plate, and incubate at 28°C for 48h to activate.
[0112] 2. Primary seed cultivation
[0113] Take 50mL of BMG shake flask culture medium, insert the activated colony on the YPD plate, shake and culture at 28°C and 250rpm for 24h, until the bacterial solution OD 600 It is around 11.
[0114] 3. Secondary seed cultivation
[0115] Take fresh BMG medium (volume is 10% of the volume of the base material in the upper tank), add the first-level seed solution to the second-level seed solution at 1-2%, and add 10×YNB and 500×Biotin to the seed solution before inoculation , 28°C, 250rpm shaking culture for 24h, to the OD of the bacterial solut...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com