Unlock instant, AI-driven research and patent intelligence for your innovation.

Cutinase producing gene engineering bacteria and use thereof

A technology of genetically engineered bacteria and cutinase, applied in genetic engineering, application, plant gene improvement, etc., can solve the problems of low translocation efficiency, inconvenient fermentation regulation, complex components, etc., and achieve the effect of low price and easy regulation of strains

Active Publication Date: 2011-06-01
JIANGNAN UNIV
View PDF4 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there are two shortcomings: feeding on the basis of compound medium, the composition is complex, and it is not convenient for fermentation regulation; the type II secretion pathway is adopted, and the two-step crossing of the inner and outer membranes of E. coli has low transport efficiency. A large amount of glycine changes the cell wall permeability to increase the level of extracellular secretion, which increases the cost of fermentation production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Example 1 : Tfu_0883-hlyAs-pET20b(+) / E. coli BL21 (DE3) build

[0031] Two pairs of primers P1, P2 and P3, P4 were designed according to the genes of cutinase and hlyAs.

[0032] P1: 5’–GTAATCCATATGGCCAACCCCTACGAGCGC–3’

[0033]P2: 5’–GACTTCCATAGGCTAAGAACGGGCAGGTGGAG–3’

[0034] P3: 5’–CTCCACCTGCCCGTTCTTAGCCTATGGAAGTC–3’

[0035] P4: 5’–CCGCTCGAGTTATGCTGATGCTGTCAAAG–3’

[0036] Using plasmid Tfu_0883 / pET20b(+) DNA as template and P1 and P2 as primers, cutinase gene Tfu_0883 was amplified by PCR. by E. coli The total DNA of CFT073 was used as a template, and the hlyAs gene was amplified by PCR using P3 and P4 as primers.

[0037] The PCR reaction was carried out in a 50 μL system, and the reaction conditions were denaturation at 94°C for 1 min, followed by a cycle of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min and 20 s, respectively. . PCR fragments of 783 bp and 180 bp were amplified respectively, and recover...

Embodiment 2

[0041] Example 2: Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3) Shake Flask Fermentation

[0042] Strain: Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3).

[0043] Seed culture: Inoculate the strains stored at -80°C into the seed medium, with an initial pH of 7.0-7.2, and cultivate on a rotary constant temperature shaker at 37°C and 200 rpm for 7-8 h. The composition of the seed medium is: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, ampicillin concentration 100mg / L.

[0044] Fermentation enzyme production: fermentation inoculation amount 5%; fermentation medium composition: glycerol 5g / L, peptone 12g / L, yeast extract 24g / L, K 2 HPO 4 12.54g / L, KH 2 PO 4 2.31g / L; after 2 hours of incubation at 37°C, the final concentration of 0.4 mM IPTG was added to induce induction, the temperature was lowered to 25°C, and the enzyme production reached 274 U / mL within 60 hours.

Embodiment 3

[0045] Example 3 : Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3) fermentation process

[0046] Strain: Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3).

[0047] Seed culture: Inoculate the strains stored at -80°C into the seed medium, with an initial pH of 7.0-7.2, and cultivate on a rotary constant temperature shaker at 37°C and 200 rpm for 7-8 h. The composition of the seed medium is: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, ampicillin concentration 100mg / L.

[0048] Fermentation inoculation amount 4%-8%.

[0049] The composition of the fermentation medium is: peptone 1g / L, yeast powder 2g / L, (NH 4 ) 2 HPO 4 4 g / L, KH 2 PO 4 13.5 g / L, MgSO 4 ·7H 2 O 4.1g / L, citric acid 0.85 g / L, glycerin 8g / L, trace element solution 5 mL / L, ampicillin concentration 100mg / L; trace element solution composition: HCl 5M / L, FeSO 4 ·7H 2 O 10 g / L, ZnSO 4 ·7H 2 O 2.25 g / L, CuSO 4 ·5H 2 O 1.0 g / L, MnSO 4 4H 2 O 0.5 g / L, Na 2 B 4 o 7 10H ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a cutinase producing gene engineering bacteria and use thereof and belongs to the technical field of bioengineering. Recombinant plasmid Tfu-0883-hlyAs / pET20b(+) is constructed, Escherichia coli E.coliBL21(DE3) is converted to obtain recombinant Escherichia coli Tfu-0883-hlyAs / pET20b(+) / E.coliBL21(DE3). A certain specific growth speed is controlled in a feed supplement batch fermentation manner, fermentation culture is performed for 30 to 34 hours, and the enzyme survival rate in fermentation supernate reaches 700 to 750U / Ml. In the invention, glycerol is used as a main raw material, a semisynthetic culture medium is adopted, and the cutinase producing gene engineering bacteria have the advantages of stability, convenient regulation and the like and are suitable for large-scale production.

Description

technical field [0001] A cutinase-producing genetically engineered bacterium and its application belong to the technical field of bioengineering. Background technique [0002] Cutinase is a multifunctional enzyme, which belongs to a kind of serine esterase. It can not only hydrolyze long-chain and short-chain fatty acid esters, emulsified triglycerides and soluble synthetic esters, but also participate in esterification and transesterification, etc. , due to the special structure of cutinase, it can also hydrolyze cutin. Therefore, it has broad application prospects in textile industry, food industry, biocatalysis, chemical industry and many other fields. [0003] The research on the fermentation process of cutinase mainly focuses on the optimization of the culture conditions of wild bacteria and the efficient expression of recombinant fungal cutinase by using different genetically engineered host cells (such as Saccharomyces cerevisiae, Escherichia coli and Aspergillus)...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/55C12N9/16C12R1/19
CPCC12Y301/01074C12N1/32C12N9/18C12N1/20
Inventor 吴敬吴丹王蕾陈坚
Owner JIANGNAN UNIV