Cutinase producing gene engineering bacteria and use thereof
A technology of genetically engineered bacteria and cutinase, applied in genetic engineering, application, plant gene improvement, etc., can solve the problems of low translocation efficiency, inconvenient fermentation regulation, complex components, etc., and achieve the effect of low price and easy regulation of strains
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Examples
Embodiment 1
[0030] Example 1 : Tfu_0883-hlyAs-pET20b(+) / E. coli BL21 (DE3) build
[0031] Two pairs of primers P1, P2 and P3, P4 were designed according to the genes of cutinase and hlyAs.
[0032] P1: 5’–GTAATCCATATGGCCAACCCCTACGAGCGC–3’
[0033]P2: 5’–GACTTCCATAGGCTAAGAACGGGCAGGTGGAG–3’
[0034] P3: 5’–CTCCACCTGCCCGTTCTTAGCCTATGGAAGTC–3’
[0035] P4: 5’–CCGCTCGAGTTATGCTGATGCTGTCAAAG–3’
[0036] Using plasmid Tfu_0883 / pET20b(+) DNA as template and P1 and P2 as primers, cutinase gene Tfu_0883 was amplified by PCR. by E. coli The total DNA of CFT073 was used as a template, and the hlyAs gene was amplified by PCR using P3 and P4 as primers.
[0037] The PCR reaction was carried out in a 50 μL system, and the reaction conditions were denaturation at 94°C for 1 min, followed by a cycle of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 1 min and 20 s, respectively. . PCR fragments of 783 bp and 180 bp were amplified respectively, and recover...
Embodiment 2
[0041] Example 2: Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3) Shake Flask Fermentation
[0042] Strain: Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3).
[0043] Seed culture: Inoculate the strains stored at -80°C into the seed medium, with an initial pH of 7.0-7.2, and cultivate on a rotary constant temperature shaker at 37°C and 200 rpm for 7-8 h. The composition of the seed medium is: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, ampicillin concentration 100mg / L.
[0044] Fermentation enzyme production: fermentation inoculation amount 5%; fermentation medium composition: glycerol 5g / L, peptone 12g / L, yeast extract 24g / L, K 2 HPO 4 12.54g / L, KH 2 PO 4 2.31g / L; after 2 hours of incubation at 37°C, the final concentration of 0.4 mM IPTG was added to induce induction, the temperature was lowered to 25°C, and the enzyme production reached 274 U / mL within 60 hours.
Embodiment 3
[0045] Example 3 : Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3) fermentation process
[0046] Strain: Escherichia coli Tfu_0883-hlyAs / pET20b(+) / E. coli BL21(DE3).
[0047] Seed culture: Inoculate the strains stored at -80°C into the seed medium, with an initial pH of 7.0-7.2, and cultivate on a rotary constant temperature shaker at 37°C and 200 rpm for 7-8 h. The composition of the seed medium is: peptone 10g / L, yeast powder 5g / L, NaCl 10g / L, ampicillin concentration 100mg / L.
[0048] Fermentation inoculation amount 4%-8%.
[0049] The composition of the fermentation medium is: peptone 1g / L, yeast powder 2g / L, (NH 4 ) 2 HPO 4 4 g / L, KH 2 PO 4 13.5 g / L, MgSO 4 ·7H 2 O 4.1g / L, citric acid 0.85 g / L, glycerin 8g / L, trace element solution 5 mL / L, ampicillin concentration 100mg / L; trace element solution composition: HCl 5M / L, FeSO 4 ·7H 2 O 10 g / L, ZnSO 4 ·7H 2 O 2.25 g / L, CuSO 4 ·5H 2 O 1.0 g / L, MnSO 4 4H 2 O 0.5 g / L, Na 2 B 4 o 7 10H ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com