cDNA of interferon (IFN)-gamma inducible lysosomal thiol reductase of sheep, cloning method and recombinant application thereof
A cloning method and lysosome technology, applied in the field of biogenetic engineering, can solve the problems of reducing T cell sensitivity, reducing autoimmunity, and lack of cross-presentation of viral antigens
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] sheep( Ovis aries ),Captivity.
[0037] (1) Primer design: The sense oligonucleotide primer Sheep GILT1 (5' - TGTGATGGCCTCGTCGCCTCTC -3', SEQ ID NO.3) and antisense oligonucleotide primer Sheep GILT2 (5'-CAGTCACTTCAAGTGGACTTCCTTG -3', SEQ ID NO.4).
[0038] (2) Extraction of total RNA: Use RNA extraction reagent TRIzol (Invitrogen Company) to extract about 0.5 g of total RNA from sheep spleen cells according to its operation manual, and identify its quality and purity by formaldehyde-denatured agarose gel electrophoresis, and use ultraviolet spectroscopy A photometer measures its concentration.
[0039] (3) Using the RT-PCR method, using the above-mentioned sheep GILT1 and sheep GILT2 as specific primers, the full-length 735bp of Sheep GILT cDNA was amplified, cloned into pMD19-T vector, and its base sequence was determined. The reaction conditions for the first step of reverse transcription are: using total RNA as a template, in a 25 μl reaction system, add 5 μl ...
Embodiment 2
[0042] Analysis of the expression level of Sheep GILT gene in various tissues:
[0043] Using the method for extracting RNA in Example 1, extracts of sheep liver (liver), kidney (kidney), lung (lung), spleen (spleen), heart (heat), intestine (intestine) and blood (PBMCs) Total RNA, using quantitative RT-PCR method to study the expression level of Sheep GILT gene in various tissues, the results are as follows image 3 As shown, the Sheep GILT gene is mainly expressed in sheep immune organs, including blood and spleen. In the experiment, sheep GAPDH was used as an internal reference, and the primers used were GF-P1 (5'-GGGTCATCATCCTCTGCACCT-3', SEQ ID NO.5) and GR-P2 (5'-GGTCATAAGTCCCCTCCACGA-3', SEQ ID NO.6). The RT-PCR system is as in Example 1.
[0044] Construction of soluble Sheep GILT recombinant vector and its induced expression in Escherichia coli:
[0045] Using the Sheep GILT full-length cDNA obtained in Example 1 as a template, primers 28-P1 (5'-AAAGGATCCATGGCCTCGT...
Embodiment 3
[0061] The cDNA of sheep IFN-γ-induced lysosomal sulfhydryl reductase obtained in Example 1 was used to produce recombinant Sheep GILT as a sheep immune enhancer through existing genetic engineering methods.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 