Unlock instant, AI-driven research and patent intelligence for your innovation.

cDNA of interferon (IFN)-gamma inducible lysosomal thiol reductase of sheep, cloning method and recombinant application thereof

A cloning method and lysosome technology, applied in the field of biogenetic engineering, can solve the problems of reducing T cell sensitivity, reducing autoimmunity, and lack of cross-presentation of viral antigens

Active Publication Date: 2012-05-02
常熟紫金知识产权服务有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CIITA is the master switch of MHC class II, and its absence does not affect the expression of GILT
[0006] (2) Studies by Maric et al. showed that the upregulation of GILT will reduce the sensitivity of T cells and thus reduce autoimmunity
[0007] (3), Reshma Singh and Peter Cresswell published an article in Science in 2010 to prove that GILT has a role in promoting the presentation of antigens in type I histocompatibility antigen complexes, Lack of cross-presentation of viral antigens in GILT- / - mice affects CD8+ T cell responses to viral antigens
[0010] To sum up, the research on GILT is a hot spot in the world, but the research on the upstream gene regulation of GILT and the downstream signaling pathway and immune regulation mechanism is relatively sufficient, but the application The research is still a blank. This topic is based on the current research status at home and abroad and the thinking of bacterial infection diseases in sheep. It is proposed to study the molecular structure, function and immune regulation mechanism of sheep GILT. For animals with low immunity and inflammatory infection diseases, Develop related immune enhancers and vaccine adjuvants

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • cDNA of interferon (IFN)-gamma inducible lysosomal thiol reductase of sheep, cloning method and recombinant application thereof
  • cDNA of interferon (IFN)-gamma inducible lysosomal thiol reductase of sheep, cloning method and recombinant application thereof
  • cDNA of interferon (IFN)-gamma inducible lysosomal thiol reductase of sheep, cloning method and recombinant application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] sheep( Ovis aries ),Captivity.

[0037] (1) Primer design: The sense oligonucleotide primer Sheep GILT1 (5' - TGTGATGGCCTCGTCGCCTCTC -3', SEQ ID NO.3) and antisense oligonucleotide primer Sheep GILT2 (5'-CAGTCACTTCAAGTGGACTTCCTTG -3', SEQ ID NO.4).

[0038] (2) Extraction of total RNA: Use RNA extraction reagent TRIzol (Invitrogen Company) to extract about 0.5 g of total RNA from sheep spleen cells according to its operation manual, and identify its quality and purity by formaldehyde-denatured agarose gel electrophoresis, and use ultraviolet spectroscopy A photometer measures its concentration.

[0039] (3) Using the RT-PCR method, using the above-mentioned sheep GILT1 and sheep GILT2 as specific primers, the full-length 735bp of Sheep GILT cDNA was amplified, cloned into pMD19-T vector, and its base sequence was determined. The reaction conditions for the first step of reverse transcription are: using total RNA as a template, in a 25 μl reaction system, add 5 μl ...

Embodiment 2

[0042] Analysis of the expression level of Sheep GILT gene in various tissues:

[0043] Using the method for extracting RNA in Example 1, extracts of sheep liver (liver), kidney (kidney), lung (lung), spleen (spleen), heart (heat), intestine (intestine) and blood (PBMCs) Total RNA, using quantitative RT-PCR method to study the expression level of Sheep GILT gene in various tissues, the results are as follows image 3 As shown, the Sheep GILT gene is mainly expressed in sheep immune organs, including blood and spleen. In the experiment, sheep GAPDH was used as an internal reference, and the primers used were GF-P1 (5'-GGGTCATCATCCTCTGCACCT-3', SEQ ID NO.5) and GR-P2 (5'-GGTCATAAGTCCCCTCCACGA-3', SEQ ID NO.6). The RT-PCR system is as in Example 1.

[0044] Construction of soluble Sheep GILT recombinant vector and its induced expression in Escherichia coli:

[0045] Using the Sheep GILT full-length cDNA obtained in Example 1 as a template, primers 28-P1 (5'-AAAGGATCCATGGCCTCGT...

Embodiment 3

[0061] The cDNA of sheep IFN-γ-induced lysosomal sulfhydryl reductase obtained in Example 1 was used to produce recombinant Sheep GILT as a sheep immune enhancer through existing genetic engineering methods.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to cDNA of interferon (IFN)-gamma inducible lysosomal thiol reductase of sheep, a cloning method and recombinant application thereof, belonging to the field of biological gene engineering. The cDNA of IFN-gamma inducible lysosomal thiol reductase of sheep has a sequence shown in SEQ ID NO.2, and the gene encoding the cDNA is shown in SEQ ID NO.1. The cloning method comprises the following steps of: designing a primer according to a conserved sequence of the IFN-gamma inducible lysosomal thiol reductase of sheep; extracting total ribonucleic acid (RNA) from spleen of sheep; and amplifying a full-length cDNA sequence through a reverse transcription-polymerase chain reaction (RT-PCR) method, cloning into pMD19-T vector, and sequencing by selecting positive clones. The cDNA of IFN-gamma inducible lysosomal thiol reductase of sheep can produce recombinant IFN-gamma inducible lysosomal thiol reductase of sheep through the conventional gene engineering method to serve as sheep immunopotentiator.

Description

technical field [0001] The invention relates to the field of biogenetic engineering, in particular to sheep IFN-γ-induced lysosome sulfhydryl reductase cDNA and its cloning and expression techniques. Background technique [0002] GILT (γ-interferon-induced lysosomal thiol reductase) was discovered in 1988 by Luster et al. After GILT is delivered to the endocytic pathway by the mannose-6-phosphate receptor in the form of a soluble glycoprotein precursor, the N- and C-terminal propeptides are cleaved to form a 30KDa mature form. Antigen presentation based on type II histocompatibility antigen complex (MHC class II) requires the processing of natural proteins into short peptides suitable for MHC binding and T cell receptor (TCR) recognition. Denaturation, unfolding, reduction of disulfide bonds, and proteolysis of antigens in antigen-presenting cells. In the whole processing pathway, the reduction of disulfide bonds is a key step. 30kDa GILT has the activity of catalyzing th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N15/10C12N15/09A61K39/00A61P37/04C12N9/02
Inventor 张双全艾洪新张真真
Owner 常熟紫金知识产权服务有限公司