Rice Lectin-like Receptor Kinase promoter (LecRKP) and applications thereof
A lectin-like and promoter-like technology, applied in the field of plant genetic engineering, can solve problems such as unclear mode of action, and achieve the effect of improving plant resistance to disease
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1: Isolation and identification of promoters
[0023] In cloning rice resistance gene to brown planthopper wxya When the gene was sequenced, the inventors analyzed it based on the sequenced information of the genome BAC clone 64O9 of the medicinal wild rice. Search the genomic sequence of this segment of O. sativa, and select the 2.5kb range upstream of the transcription initiation site of the gene as a candidate promoter region for PCR amplification. Design primers: F( agtcggatcc gggattttgggaaaatgtga) and R ( agtcggatcc tgttctttgcttcaggctctt), the underline indicates the protected base and the added restriction site. First, using primers to extract the genomic DNA of medicinal wild rice (CTAB method, Zhang QF et al., 1992, Genetic diversity and differentiation of indica and japonica rice detected by RFLP analysis. Theor. Appl. Genet.83, 495-499) as the template for amplification, the reaction conditions are: 94°C 5min; 94°C 30sec, 55°C 45sec, 72°C 3min,...
Embodiment 2
[0024] Example 2: Rice lectin-like kinase gene LecRK tissue-specific expression of
[0025] The recipient material Hejiang 19 (purchased from the National Rice Germplasm Bank) was used as the research material, and the coleoptile, shoot, root, root, apical meristem, stem, leaf and flower were collected at different growth stages. 2g was immediately sealed in liquid nitrogen for preservation. Total RNA was extracted with Invitrogen's TRIzol and then Fermentas' RevertAid TM The first strand cDNA synthesis kit reversely synthesizes the first strand of cDNA. Detection of Lectin-like Kinase Genes from Different Tissues Using BIO-RAD MyCyler Thermal Cyler wxya Semi-quantitative PCR detection was performed. 10ul reaction system for PCR: 0.1ul cDNA template, 1XPCR buffer (Mg 2+ ), dNTP 1mM, primer 2uM, Fermentas Taq DNA Polymerase 0.3U, add sterilized water to 10ul. The reaction conditions are: 94°C for 4 min; 94°C for 30 sec, 55°C for 30 sec, 72°C for 30 sec, 40 cycles. Tak...
Embodiment 3
[0026] Example 3: Identification of promoter expression activity
[0027] In the embodiment of the present invention, a GUS gene expression vector of the promoter was constructed and transformed into a rice variety, and the tissue-specific expression activity of the promoter was observed by GUS color development. The specific operation is as follows:
[0028] First, the T vector containing the promoter obtained in Example 1 is expanded and cultivated, the plasmid is extracted, and the BamHI Enzyme digestion, the total volume of the reaction system is 20 μl: about 5 μl (2 μg) of the T vector containing the promoter, 1× reaction buffer, BamHI 0.5U, after mixing, digest overnight at 37°C, and recover the desired fragments by agarose gel electrophoresis. The pCAMBIA1381z vector digestion system is the same as above, and the kit is purified and recovered. Connect the promoter fragment into the pCAMBIA1381z vector, and the reaction system is the same as above ( image 3 ). Ag...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More