Supercharge Your Innovation With Domain-Expert AI Agents!

Fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting pathogenic aspergillus, detection probe and kit

A technology for detection kits and detection probes, applied in fluorescence/phosphorescence, biochemical equipment and methods, microbial measurement/inspection, etc., can solve the problems of lack of specificity, low positive rate, difficult to obtain materials, etc., and achieve high sensitivity High specificity and specificity, high specificity and sensitivity, and easy sampling

Inactive Publication Date: 2012-01-18
GUANGZHOU INST OF RESPIRATORY DISEASE
View PDF4 Cites 22 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods have certain defects and limitations: traditional culture and microscopic examination methods have a low positive rate and take a long time; histopathological examination is an invasive operation, it is not easy to obtain materials, and immunohistochemical methods are required to further identify the bacteria species ; The Halo sign seen on imaging examinations is a characteristic manifestation of early invasive pulmonary aspergillosis, but lacks specificity; serological examination of specific antigens or metabolites such as detection of galactomannan antigen (GM antigen) and (1→3)2β2D2 glucan (G test) is quick and easy, but its sensitivity, specificity and value in early diagnosis and disease monitoring are still unsatisfactory, and the strains of Aspergillus cannot be identified
The advantage of this method is that it is simple and easy to implement, and the main disadvantage is that the specificity is not strong. The dye can bind to any double-stranded DNA, and it cannot distinguish primer dimers, non-specific amplification products and specific amplification products.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting pathogenic aspergillus, detection probe and kit
  • Fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting pathogenic aspergillus, detection probe and kit
  • Fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting pathogenic aspergillus, detection probe and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] The fluorescent quantitative PCR kit that detects pathogenic Aspergillus described in this embodiment includes:

[0070] A. Fungal Universal Primer Sequence:

[0071] Forward primer (P1): 5'~GTGAATCATCGAGTCTTTGAAC~3' (SEQ ID.NO: 1)

[0072] Reverse primer (P2): 5'~TCCTCCGCTTATTGATATGC~3'; (SEQ ID.NO: 2)

[0073] B. 4 kinds of specific fluorescent quantitative PCR primer probe sequences and fluorescent labels, as shown in the following table:

[0074]

[0075] For the gene positioning effect of primers and probes, see figure 1 .

[0076] 3.2 Utilize the synthetic universal primer to amplify four kinds of standard Aspergillus strains to be tested by common PCR,

[0077] The DNA of four kinds of Aspergillus extracted by conventional methods is used as template, the PCR reaction volume is 25ul, the reaction system includes Taq enzyme 0.125ul, 10×Buffer 2.5ul, dNTP 2ul, universal primer (0.1mmol / l) each 1ul, DNA template 1ul , add DEPC water to 25ul. A negative cont...

Embodiment 2

[0084] Embodiment 2: the specificity of multiplex fluorescence quantitative PCR method

[0085] After extracting DNA from standard strains, human whole blood cell DNA and clinically common pathogenic isolates used in this study, amplify them by multiplex fluorescent quantitative PCR according to the detection method described in Example 1 to detect their specificity. sex.

[0086] Various Aspergillus, Candida, standard strain DNA, clinical isolate strain DNA, and human whole blood cell DNA were amplified by multiplex fluorescent quantitative PCR. The Ct values ​​of Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus, and Aspergillus niger were all ≤35.0, and the identification results were positive, while other Aspergillus, Candida, bacteria (such as Escherichia coli (ATCC35218), Klebsiella pneumoniae (ATCC 700603) ), Enterobacter cloacae (ATCC 700323), Pseudomonas aeruginosa (ATCC 27853), Staphylococcus aureus (ATCC 25922), and Haemophilus influenzae (ATCC 49247))...

Embodiment 3

[0089] Embodiment 3: the sensitivity of multiplex fluorescent quantitative PCR method

[0090] Dilute the spore suspension of Aspergillus fumigatus, Aspergillus flavus, Aspergillus terreus and Aspergillus niger by 10 times: 1×10 7 , 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 , 1×10 0 Spores / ml. After routinely extracting DNA, perform multiple fluorescent quantitative PCR amplification, the lowest detection rate is 1×10 2 Spores / ml of the above four Aspergillus species to be tested. Figure 11-14 It is the sensitivity result of detection of Aspergillus by multiplex fluorescent quantitative PCR method. (In the figure, from left to right are 1×10 7 Spores / ml, 1×10 6Spores / ml, 1×10 5 Spores / ml, 1×10 4 Spores / ml, 1×10 3 Spores / ml, 1×10 2 Spore / ml)

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting aspergillus, detection probes and a detection kit, wherein the detection kit comprises universal premiers displayed by base compositions such as SEQ ID. NO: 1 and SEQ ID. NO: 2; and the detection probe is CY5-TAAAGTTGGGTGTCGGCTGG-BHQ aiming at aspergillus fumigatus, the detection probe is FAM-TTGATTTGCGTTCGGCAAGC-BHQ aiming at aspergillus flavus, the detection probe is HEX-ACAAGTTGCAAATAAATGCGTCG-BHQ aiming at aspergillus, and / or the detection probe is ROX-ATGGTTGGAAAACGTCGGCA-BHQ aiming at aspergillus Niger. The multiple PCR detection method, premier, the probes and the kit thereof provided by the invention aim at four main pathogenic aspergilli and have high specificity and sensitivity; and the detection method is rapid, simple and convenient, and can be used for detecting and identifying the strain of pathogenic bacteria.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a fluorescent quantitative PCR general primer, a detection probe and a kit for detecting pathogenic aspergillus. Background technique [0002] In recent years, with the wide application of broad-spectrum antibiotics and immunosuppressants and the increasing number of immunocompromised populations such as hematological malignancies and organ transplants, the incidence of deep fungal infections is rising sharply. Among them, Aspergillus has become an important pathogenic fungus second only to Candida albicans in immunocompromised patients. Aspergillus infection occurs in up to 50% of immunocompromised patients. Aspergillus infection, especially invasive aspergillosis, has a poor prognosis. Although new antifungal drugs are emerging and used in clinical treatment, the fatality rate is still as high as 50% to 90%. Due to the non-specific clinical manifestations of the disea...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N15/11G01N21/64
Inventor 黎毅敏邱桂霞毛璞杨淳黄红川刘冬冬刘晓青何为群莫红缨
Owner GUANGZHOU INST OF RESPIRATORY DISEASE
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More